Incidental Mutation 'R2279:Lrrc4c'
ID242949
Institutional Source Beutler Lab
Gene Symbol Lrrc4c
Ensembl Gene ENSMUSG00000050587
Gene Nameleucine rich repeat containing 4C
Synonymsnetrin g1 ligand, 6430556C10Rik
MMRRC Submission 040278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R2279 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location96318169-97631666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97630505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 492 (S492F)
Ref Sequence ENSEMBL: ENSMUSP00000125218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059049] [ENSMUST00000135431] [ENSMUST00000162807] [ENSMUST00000170144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059049
AA Change: S492F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131795
Gene: ENSMUSG00000050587
AA Change: S492F

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135431
AA Change: S492F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130984
Gene: ENSMUSG00000050587
AA Change: S492F

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162807
AA Change: S492F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125218
Gene: ENSMUSG00000050587
AA Change: S492F

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199276
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NGL1 is a specific binding partner for netrin G1 (NTNG1; MIM 608818), which is a member of the netrin family of axon guidance molecules (Lin et al., 2003 [PubMed 14595443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice exhibited an increased mean serum IL-6 response to LPS challenge when compared with controls. No other notable phenotype was detected in a high-througput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,981,642 Y68H probably damaging Het
Ankrd17 G T 5: 90,264,717 N1249K probably damaging Het
Anks1b T C 10: 90,050,096 M218T probably damaging Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cabin1 T C 10: 75,753,461 I87M probably benign Het
Cdc42bpa A G 1: 180,036,919 N149D probably damaging Het
Cdh20 C A 1: 104,947,414 A307E probably damaging Het
Cdk18 A T 1: 132,115,952 Y385N probably damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cptp A G 4: 155,866,421 I196T probably damaging Het
Cyp4b1 T A 4: 115,640,360 Y147F probably benign Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dbr1 G T 9: 99,580,147 Q166H probably benign Het
Ddx42 T A 11: 106,242,939 D580E probably damaging Het
Dnah17 T C 11: 118,096,561 K1308E possibly damaging Het
Dpep1 A T 8: 123,194,144 D21V probably benign Het
Dspp G A 5: 104,178,384 S871N unknown Het
En1 T A 1: 120,607,187 *402K probably null Het
Eogt G T 6: 97,134,301 R200S probably benign Het
Epb41l3 A G 17: 69,270,650 T542A possibly damaging Het
Fam198a T C 9: 121,965,602 I274T probably benign Het
Fam208a A C 14: 27,442,495 K253Q probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gh T C 11: 106,300,787 E143G probably damaging Het
Hcn3 C A 3: 89,147,861 R693L probably benign Het
Htra1 A T 7: 130,962,022 I208F probably damaging Het
Ifna13 T A 4: 88,643,919 E156V probably benign Het
Ints6 A G 14: 62,704,682 probably null Het
Kifc5b A G 17: 26,925,541 I545V probably damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Map2k6 T C 11: 110,499,464 S275P probably damaging Het
Mpp2 T C 11: 102,064,301 E166G probably damaging Het
Mrpl48 G A 7: 100,565,264 T48I probably damaging Het
Neu1 A G 17: 34,934,374 D291G probably damaging Het
Nktr A G 9: 121,731,537 K116E possibly damaging Het
Npc1 T C 18: 12,197,179 probably null Het
Olfr1046 T C 2: 86,216,804 E302G probably benign Het
Olfr6 A T 7: 106,956,627 M103K probably benign Het
Olfr786 A T 10: 129,437,657 M282L probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rnf32 G T 5: 29,225,280 V366F probably benign Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sirt7 T C 11: 120,624,495 S112G probably damaging Het
Slc1a6 A T 10: 78,789,048 M96L probably benign Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc30a2 G T 4: 134,348,546 Q210H probably benign Het
Sorcs2 A T 5: 36,042,086 probably null Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Sytl3 A G 17: 6,708,874 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem45a A T 16: 56,823,519 L89Q probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Txlna T C 4: 129,632,142 E304G probably damaging Het
Zfp709 T C 8: 71,889,090 V121A probably benign Het
Other mutations in Lrrc4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lrrc4c APN 2 97630385 nonsense probably null
IGL02095:Lrrc4c APN 2 97629404 missense probably benign 0.05
IGL02165:Lrrc4c APN 2 97629033 start codon destroyed probably null 0.33
IGL02176:Lrrc4c APN 2 97630253 missense probably damaging 0.96
IGL02674:Lrrc4c APN 2 97629775 missense probably damaging 0.99
IGL03082:Lrrc4c APN 2 97630586 missense probably benign 0.05
IGL03303:Lrrc4c APN 2 97629592 missense probably damaging 1.00
R0946:Lrrc4c UTSW 2 97629464 missense probably benign 0.00
R1037:Lrrc4c UTSW 2 97629985 missense probably benign
R1518:Lrrc4c UTSW 2 97630576 missense probably benign
R1559:Lrrc4c UTSW 2 97630772 missense probably benign 0.00
R2192:Lrrc4c UTSW 2 97629312 missense possibly damaging 0.50
R2213:Lrrc4c UTSW 2 97630471 missense probably benign 0.29
R3552:Lrrc4c UTSW 2 97629961 missense probably damaging 1.00
R3840:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R3841:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R4606:Lrrc4c UTSW 2 97630313 missense probably benign 0.22
R4938:Lrrc4c UTSW 2 97629301 missense probably damaging 1.00
R4946:Lrrc4c UTSW 2 97630489 missense probably benign 0.00
R5323:Lrrc4c UTSW 2 97630153 missense probably damaging 1.00
R6014:Lrrc4c UTSW 2 97629212 unclassified probably null
R6297:Lrrc4c UTSW 2 97629619 missense probably damaging 0.99
R6376:Lrrc4c UTSW 2 97629046 missense probably benign 0.03
R7032:Lrrc4c UTSW 2 97629065 missense probably benign
R7419:Lrrc4c UTSW 2 97629761 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCTTCTGCCACCTTGAATG -3'
(R):5'- CCACGTTAATGATTTCAACAGTCC -3'

Sequencing Primer
(F):5'- TGAATGTTACTGCGGCAACC -3'
(R):5'- GCTGTTTCCTCATCTTGTAGAAAATG -3'
Posted On2014-10-16