Incidental Mutation 'R2279:Cyp4b1'
ID242957
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 040278-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2279 (G1)
Quality Score215
Status Not validated
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115640360 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 147 (Y147F)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably benign
Transcript: ENSMUST00000102707
AA Change: Y147F

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: Y147F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135569
AA Change: Y23F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143237
Predicted Effect unknown
Transcript: ENSMUST00000145841
AA Change: Y57F
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: Y57F

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,981,642 Y68H probably damaging Het
Ankrd17 G T 5: 90,264,717 N1249K probably damaging Het
Anks1b T C 10: 90,050,096 M218T probably damaging Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cabin1 T C 10: 75,753,461 I87M probably benign Het
Cdc42bpa A G 1: 180,036,919 N149D probably damaging Het
Cdh20 C A 1: 104,947,414 A307E probably damaging Het
Cdk18 A T 1: 132,115,952 Y385N probably damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cptp A G 4: 155,866,421 I196T probably damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dbr1 G T 9: 99,580,147 Q166H probably benign Het
Ddx42 T A 11: 106,242,939 D580E probably damaging Het
Dnah17 T C 11: 118,096,561 K1308E possibly damaging Het
Dpep1 A T 8: 123,194,144 D21V probably benign Het
Dspp G A 5: 104,178,384 S871N unknown Het
En1 T A 1: 120,607,187 *402K probably null Het
Eogt G T 6: 97,134,301 R200S probably benign Het
Epb41l3 A G 17: 69,270,650 T542A possibly damaging Het
Fam198a T C 9: 121,965,602 I274T probably benign Het
Fam208a A C 14: 27,442,495 K253Q probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gh T C 11: 106,300,787 E143G probably damaging Het
Hcn3 C A 3: 89,147,861 R693L probably benign Het
Htra1 A T 7: 130,962,022 I208F probably damaging Het
Ifna13 T A 4: 88,643,919 E156V probably benign Het
Ints6 A G 14: 62,704,682 probably null Het
Kifc5b A G 17: 26,925,541 I545V probably damaging Het
Lrrc4c C T 2: 97,630,505 S492F possibly damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Map2k6 T C 11: 110,499,464 S275P probably damaging Het
Mpp2 T C 11: 102,064,301 E166G probably damaging Het
Mrpl48 G A 7: 100,565,264 T48I probably damaging Het
Neu1 A G 17: 34,934,374 D291G probably damaging Het
Nktr A G 9: 121,731,537 K116E possibly damaging Het
Npc1 T C 18: 12,197,179 probably null Het
Olfr1046 T C 2: 86,216,804 E302G probably benign Het
Olfr6 A T 7: 106,956,627 M103K probably benign Het
Olfr786 A T 10: 129,437,657 M282L probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rnf32 G T 5: 29,225,280 V366F probably benign Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sirt7 T C 11: 120,624,495 S112G probably damaging Het
Slc1a6 A T 10: 78,789,048 M96L probably benign Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc30a2 G T 4: 134,348,546 Q210H probably benign Het
Sorcs2 A T 5: 36,042,086 probably null Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Sytl3 A G 17: 6,708,874 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem45a A T 16: 56,823,519 L89Q probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Txlna T C 4: 129,632,142 E304G probably damaging Het
Zfp709 T C 8: 71,889,090 V121A probably benign Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0143:Cyp4b1 UTSW 4 115635874 missense probably damaging 0.99
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0725:Cyp4b1 UTSW 4 115626827 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1084:Cyp4b1 UTSW 4 115640312 missense probably benign 0.00
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R2885:Cyp4b1 UTSW 4 115635652 missense probably damaging 1.00
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
R7584:Cyp4b1 UTSW 4 115628687 missense probably damaging 0.98
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCATTGCTACAGGTATAGG -3'
(R):5'- TCCATGTAGTGTTCCAGGCTTG -3'

Sequencing Primer
(F):5'- CCATTGCTACAGGTATAGGGATGAC -3'
(R):5'- CCAGGCTTGGGAGTGTCAGAG -3'
Posted On2014-10-16