Incidental Mutation 'R0172:Lipg'
ID24300
Institutional Source Beutler Lab
Gene Symbol Lipg
Ensembl Gene ENSMUSG00000053846
Gene Namelipase, endothelial
Synonymsendothelial lipase, EL, mEDL, 3110013K01Rik
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0172 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location74939322-74961263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74948174 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 279 (H279N)
Ref Sequence ENSEMBL: ENSMUSP00000066536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066532
AA Change: H279N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066536
Gene: ENSMUSG00000053846
AA Change: H279N

DomainStartEndE-ValueType
Pfam:Lipase 20 344 3.1e-108 PFAM
LH2 347 483 5.66e-6 SMART
Meta Mutation Damage Score 0.4798 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating total cholesterol and HDL as well as decreased monocyte binding to vascular endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Lipg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Lipg APN 18 74947971 critical splice donor site probably null
IGL02340:Lipg APN 18 74960875 splice site probably null
IGL02804:Lipg APN 18 74949088 missense probably damaging 0.98
listube UTSW 18 74957236 missense probably benign 0.00
R0094:Lipg UTSW 18 74945846 missense probably benign 0.14
R0316:Lipg UTSW 18 74960941 missense probably benign 0.01
R0535:Lipg UTSW 18 74954220 missense probably damaging 1.00
R0567:Lipg UTSW 18 74957369 missense probably benign 0.01
R1171:Lipg UTSW 18 74945823 missense possibly damaging 0.71
R1554:Lipg UTSW 18 74948047 missense probably damaging 1.00
R1611:Lipg UTSW 18 74948059 missense possibly damaging 0.81
R1916:Lipg UTSW 18 74960937 missense probably benign 0.00
R2125:Lipg UTSW 18 74945885 missense probably benign
R4196:Lipg UTSW 18 74945831 missense probably damaging 1.00
R4629:Lipg UTSW 18 74948036 nonsense probably null
R5186:Lipg UTSW 18 74960938 missense probably benign 0.00
R5424:Lipg UTSW 18 74954253 missense probably damaging 1.00
R5708:Lipg UTSW 18 74955434 missense possibly damaging 0.49
R6416:Lipg UTSW 18 74957236 missense probably benign 0.00
R6493:Lipg UTSW 18 74948024 missense probably damaging 0.99
R6601:Lipg UTSW 18 74948204 missense probably benign
R7199:Lipg UTSW 18 74955584 missense probably benign 0.01
R7857:Lipg UTSW 18 74945820 missense probably damaging 1.00
R7884:Lipg UTSW 18 74948007 missense probably damaging 1.00
R7940:Lipg UTSW 18 74945820 missense probably damaging 1.00
R7967:Lipg UTSW 18 74948007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTACACACCCTGCTCTTCAAG -3'
(R):5'- CCTGTGTTAAGAATCACCCACTGCC -3'

Sequencing Primer
(F):5'- AAGCCTAAGGGGCACTTG -3'
(R):5'- CAGCCTTAACAAACCTAACTGG -3'
Posted On2013-04-16