Mutagenetix > Incidental Mutations

Incidental Mutation 'R2280:Gm8251'

243013

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

040279-MU

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R2280 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44056460 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1826 (H1826L)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168641
AA Change: H1826L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: H1826L

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	A	G	6: 85,677,973	N2698S	probably damaging	Het
Ankrd37	T	C	8: 45,999,376	T19A	probably benign	Het
Anks1b	A	C	10: 90,966,302	K353N	probably damaging	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3b1	A	G	13: 94,528,216	M888V	unknown	Het
Apoh	T	A	11: 108,409,180	Y218*	probably null	Het
Arhgef19	G	A	4: 141,246,516	G105S	probably benign	Het
Brd7	A	G	8: 88,342,757	S437P	probably benign	Het
Cacna2d4	A	T	6: 119,350,041	Q1089L	possibly damaging	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cep170	A	T	1: 176,774,505	V345E	probably benign	Het
Chaf1b	T	G	16: 93,891,571	Y185D	probably damaging	Het
Clasp1	C	T	1: 118,565,183	P1153S	probably benign	Het
Clvs2	A	T	10: 33,528,500	I240N	probably damaging	Het
Cox8c	A	T	12: 102,899,454	H30L	possibly damaging	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp46a1	T	C	12: 108,355,471	S319P	probably damaging	Het
Dcdc5	G	A	2: 106,372,522		noncoding transcript	Het
Ddx4	T	C	13: 112,620,656	I377V	probably benign	Het
Dis3l	T	A	9: 64,317,794	N407I	possibly damaging	Het
Dysf	A	C	6: 84,064,494	T161P	probably damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Ei24	A	G	9: 36,782,339		probably null	Het
Fbxl19	A	T	7: 127,748,368	D32V	possibly damaging	Het
Fgd5	G	A	6: 91,988,945	V562M	possibly damaging	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Frem2	A	G	3: 53,572,423	C1950R	probably damaging	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Gbx2	A	T	1: 89,930,637	V40D	probably damaging	Het
Gcc2	C	A	10: 58,269,680	T210K	probably benign	Het
Gcn1l1	T	A	5: 115,612,730	M1991K	probably damaging	Het
Gm6768	A	G	12: 119,262,838		noncoding transcript	Het
Gpr18	T	A	14: 121,912,605	T3S	probably benign	Het
Herc2	A	C	7: 56,137,271	K1621N	possibly damaging	Het
Hspg2	A	G	4: 137,522,043	E1300G	probably damaging	Het
Krtap19-5	C	T	16: 88,896,343	C27Y	unknown	Het
Lrrc3b	A	T	14: 15,358,076	L177M	probably damaging	Het
Mthfd1	T	C	12: 76,280,492	I118T	probably benign	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Npy1r	C	T	8: 66,704,059	L44F	possibly damaging	Het
Olfr433	C	A	1: 174,042,521	S190R	probably benign	Het
Pcx	C	A	19: 4,604,543	R328S	probably damaging	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Pum1	A	T	4: 130,766,011	I696F	probably damaging	Het
Pxdn	T	C	12: 29,984,906	V254A	probably damaging	Het
Rcsd1	C	T	1: 165,659,429	A72T	probably benign	Het
Rsph4a	A	T	10: 33,911,599	I584L	probably benign	Het
Scamp5	A	G	9: 57,445,439	V149A	probably benign	Het
Sike1	A	G	3: 102,997,378	H134R	possibly damaging	Het
Slc12a9	A	G	5: 137,332,212	L77P	probably damaging	Het
Taar7f	G	A	10: 24,049,519	A4T	probably benign	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tpsg1	C	T	17: 25,374,042	R94C	probably damaging	Het
Utp20	A	T	10: 88,825,503		probably null	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Zfp12	A	G	5: 143,245,493	Y525C	probably damaging	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het
Zfyve26	T	A	12: 79,275,040	Q935L	probably damaging	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATTTGGCTCTGGCATCTG -3'
(R):5'- CCCATAGACAGCATATCTTCCCTG -3'

Sequencing Primer
(F):5'- ACTGCGTAAGTGGCTGTAATG -3'
(R):5'- TGTGGCACAACCTTTCTATCAG -3'

Posted On

2014-10-16