Incidental Mutation 'R2280:Gbx2'
ID243014
Institutional Source Beutler Lab
Gene Symbol Gbx2
Ensembl Gene ENSMUSG00000034486
Gene Namegastrulation brain homeobox 2
SynonymsGbx-2, Stra7, MMoxA
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location89927956-89931179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89930637 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 40 (V40D)
Ref Sequence ENSEMBL: ENSMUSP00000048508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036954]
Predicted Effect probably damaging
Transcript: ENSMUST00000036954
AA Change: V40D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048508
Gene: ENSMUSG00000034486
AA Change: V40D

DomainStartEndE-ValueType
low complexity region 56 82 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
HOX 247 309 7.58e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189763
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with vascular, neurological, skeletal, and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Gbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Gbx2 APN 1 89928837 missense probably damaging 1.00
IGL01804:Gbx2 APN 1 89928981 missense probably benign 0.00
IGL02345:Gbx2 APN 1 89928976 missense probably benign 0.00
IGL02370:Gbx2 APN 1 89929149 splice site probably benign
IGL02957:Gbx2 APN 1 89930653 missense probably benign 0.02
IGL02959:Gbx2 APN 1 89928795 missense probably damaging 1.00
R2405:Gbx2 UTSW 1 89930908 start gained probably benign
R2860:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R2861:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R5384:Gbx2 UTSW 1 89928913 missense probably damaging 1.00
R5587:Gbx2 UTSW 1 89933122 unclassified probably benign
R5747:Gbx2 UTSW 1 89928715 missense probably damaging 0.98
R5956:Gbx2 UTSW 1 89933186 unclassified probably benign
R6053:Gbx2 UTSW 1 89930437 missense probably benign 0.00
R6633:Gbx2 UTSW 1 89928720 frame shift probably null
R7479:Gbx2 UTSW 1 89930651 missense probably benign 0.02
R7505:Gbx2 UTSW 1 89928733 missense probably benign 0.26
R7768:Gbx2 UTSW 1 89928984 missense probably benign 0.09
R8184:Gbx2 UTSW 1 89928828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCGAAGTTGCCGCCTC -3'
(R):5'- GGACACGGGGACTTTTCGT -3'

Sequencing Primer
(F):5'- GCTGTGGAGCGAACTTGC -3'
(R):5'- GGACTTTTCGTCTCTCCCTGG -3'
Posted On2014-10-16