Incidental Mutation 'R0172:Slc22a27'
ID24302
Institutional Source Beutler Lab
Gene Symbol Slc22a27
Ensembl Gene ENSMUSG00000067656
Gene Namesolute carrier family 22, member 27
SynonymsmOAT6 related protein, AB056442
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0172 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location7864388-7966027 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 7865836 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 393 (G393*)
Ref Sequence ENSEMBL: ENSMUSP00000138475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075619] [ENSMUST00000182102]
Predicted Effect probably null
Transcript: ENSMUST00000075619
AA Change: G501*
SMART Domains Protein: ENSMUSP00000093991
Gene: ENSMUSG00000067656
AA Change: G501*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.5e-25 PFAM
Pfam:MFS_1 140 372 1.3e-15 PFAM
Pfam:MFS_1 349 549 8.3e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182102
AA Change: G393*
SMART Domains Protein: ENSMUSP00000138475
Gene: ENSMUSG00000067656
AA Change: G393*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 241 441 1.2e-11 PFAM
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Slc22a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Slc22a27 APN 19 7909743 missense possibly damaging 0.93
IGL02516:Slc22a27 APN 19 7864811 missense probably damaging 0.99
IGL02961:Slc22a27 APN 19 7926521 missense probably damaging 0.99
IGL03008:Slc22a27 APN 19 7909702 missense possibly damaging 0.92
PIT4544001:Slc22a27 UTSW 19 7909738 missense probably damaging 1.00
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0280:Slc22a27 UTSW 19 7896822 nonsense probably null
R0561:Slc22a27 UTSW 19 7880162 critical splice donor site probably null
R0597:Slc22a27 UTSW 19 7865884 missense probably benign 0.00
R1005:Slc22a27 UTSW 19 7926751 missense probably damaging 1.00
R1165:Slc22a27 UTSW 19 7909694 intron probably null
R1217:Slc22a27 UTSW 19 7926668 missense probably benign 0.01
R1533:Slc22a27 UTSW 19 7866983 missense possibly damaging 0.79
R1940:Slc22a27 UTSW 19 7909727 missense probably damaging 1.00
R3714:Slc22a27 UTSW 19 7926450 missense possibly damaging 0.75
R3959:Slc22a27 UTSW 19 7910049 missense probably damaging 1.00
R4059:Slc22a27 UTSW 19 7879608 splice site probably benign
R4249:Slc22a27 UTSW 19 7925879 missense possibly damaging 0.64
R4748:Slc22a27 UTSW 19 7925876 missense probably benign
R5220:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5221:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5232:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5330:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5331:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5345:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5427:Slc22a27 UTSW 19 7879388 critical splice donor site probably null
R5534:Slc22a27 UTSW 19 7926631 missense probably damaging 1.00
R5691:Slc22a27 UTSW 19 7926670 missense possibly damaging 0.90
R5828:Slc22a27 UTSW 19 7926402 missense probably damaging 1.00
R5878:Slc22a27 UTSW 19 7926757 missense probably benign 0.01
R5918:Slc22a27 UTSW 19 7910046 missense possibly damaging 0.91
R6185:Slc22a27 UTSW 19 7926588 missense probably benign 0.14
R6901:Slc22a27 UTSW 19 7926579 missense probably damaging 1.00
R7139:Slc22a27 UTSW 19 7926547 missense probably damaging 1.00
R7336:Slc22a27 UTSW 19 7926689 missense probably benign 0.02
R7502:Slc22a27 UTSW 19 7926382 missense probably damaging 1.00
R7556:Slc22a27 UTSW 19 7865754 missense probably damaging 0.98
R7737:Slc22a27 UTSW 19 7896762 missense probably damaging 0.99
R7860:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R7943:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R8050:Slc22a27 UTSW 19 7880167 missense probably benign 0.18
R8150:Slc22a27 UTSW 19 7910025 missense possibly damaging 0.87
RF012:Slc22a27 UTSW 19 7926584 missense probably benign 0.07
Z1177:Slc22a27 UTSW 19 7909730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTAGACTTTGTGACTTAGAGAGCCTC -3'
(R):5'- TGTGTTGCATAAGGAAGTGTCTTCTTCA -3'

Sequencing Primer
(F):5'- CTAGGGACTTCTGAATCTACAGGAC -3'
(R):5'- TTTGAGAAGGACGAGTAACTTACC -3'
Posted On2013-04-16