Incidental Mutation 'R2280:Arhgef19'
ID243027
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene NameRho guanine nucleotide exchange factor (GEF) 19
Synonyms6430573B13Rik, WGEF
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141239499-141257564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141246516 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 105 (G105S)
Ref Sequence ENSEMBL: ENSMUSP00000119846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618] [ENSMUST00000125392] [ENSMUST00000135623] [ENSMUST00000138096] [ENSMUST00000141834] [ENSMUST00000147903]
Predicted Effect probably benign
Transcript: ENSMUST00000006618
AA Change: G105S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: G105S

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125392
AA Change: G105S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000135623
AA Change: G105S

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119846
Gene: ENSMUSG00000028919
AA Change: G105S

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140536
SMART Domains Protein: ENSMUSP00000114784
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141834
Predicted Effect unknown
Transcript: ENSMUST00000147903
AA Change: G41S
SMART Domains Protein: ENSMUSP00000120088
Gene: ENSMUSG00000028919
AA Change: G41S

DomainStartEndE-ValueType
low complexity region 147 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184162
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 141248983 unclassified probably benign
IGL02037:Arhgef19 APN 4 141246396 missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 141254316 missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 141249002 missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 141247568 missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 141250607 missense probably benign 0.00
R0319:Arhgef19 UTSW 4 141256399 missense possibly damaging 0.63
R1572:Arhgef19 UTSW 4 141254754 missense probably benign 0.10
R1633:Arhgef19 UTSW 4 141238560 unclassified probably benign
R1735:Arhgef19 UTSW 4 141249618 missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 141251043 missense probably benign 0.27
R1823:Arhgef19 UTSW 4 141249146 missense probably benign 0.01
R1889:Arhgef19 UTSW 4 141249313 missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 141250800 missense probably damaging 1.00
R3430:Arhgef19 UTSW 4 141256800 missense probably benign 0.03
R3954:Arhgef19 UTSW 4 141256334 missense probably damaging 1.00
R4158:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 141247515 unclassified probably null
R5031:Arhgef19 UTSW 4 141250810 missense probably damaging 0.98
R5782:Arhgef19 UTSW 4 141256312 missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 141249298 missense probably benign 0.03
R7614:Arhgef19 UTSW 4 141256779 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTTTCCCATTGCTCCAGAGG -3'
(R):5'- TACATAGAGACTAGAGGGCCTGAC -3'

Sequencing Primer
(F):5'- TCCAGAGGAGCTGCAAGC -3'
(R):5'- TGACTTCTCTGAGCCACT -3'
Posted On2014-10-16