Incidental Mutation 'R2280:Nphp4'
ID243028
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152557043 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1094 (K1094E)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056567
AA Change: K1094E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: K1094E

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081393
AA Change: K1094E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: K1094E

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152518196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAGCACAGCGATGCTC -3'
(R):5'- TACCAGGGCAATCCATCCATG -3'

Sequencing Primer
(F):5'- AGCACAGCGATGCTCTGGAG -3'
(R):5'- ACTGTCTGGGCACAGCTGAG -3'
Posted On2014-10-16