Incidental Mutation 'R2280:Alms1'
ID243040
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85677973 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2698 (N2698S)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably damaging
Transcript: ENSMUST00000072018
AA Change: N2698S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: N2698S

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202081
Predicted Effect possibly damaging
Transcript: ENSMUST00000213058
AA Change: N3167S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGCCTCAGCATCAACTTG -3'
(R):5'- TAAAGTCCCCTGTACTCTGGC -3'

Sequencing Primer
(F):5'- CCTCAGCATCAACTTGAATTTGGGAG -3'
(R):5'- GTACTCTGGCCCCTCTCTAGG -3'
Posted On2014-10-16