Incidental Mutation 'R2280:Zfyve26'
ID243065
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79275040 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 935 (Q935L)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]
Predicted Effect probably damaging
Transcript: ENSMUST00000021547
AA Change: Q935L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: Q935L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 intron probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 intron probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 intron probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTACCCCGACTCTCAAGG -3'
(R):5'- CCATGAATGGGCCCTAATGAAAG -3'

Sequencing Primer
(F):5'- ACTCTCAAGGCTGCTGCTCAG -3'
(R):5'- GGCCCTAATGAAAGCCTATTGTGC -3'
Posted On2014-10-16