Incidental Mutation 'R2280:Lrrc3b'
ID243071
Institutional Source Beutler Lab
Gene Symbol Lrrc3b
Ensembl Gene ENSMUSG00000045201
Gene Nameleucine rich repeat containing 3B
SynonymsLRP15
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location15357515-15438987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15358076 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 177 (L177M)
Ref Sequence ENSEMBL: ENSMUSP00000153616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]
Predicted Effect probably damaging
Transcript: ENSMUST00000055211
AA Change: L177M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: L177M

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163937
AA Change: L177M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: L177M

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223700
AA Change: L177M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp12 A G 5: 143,245,493 Y525C probably damaging Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Lrrc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lrrc3b APN 14 15358098 missense probably benign 0.00
IGL03141:Lrrc3b APN 14 15358390 missense probably damaging 1.00
Klutz UTSW 14 15357946 missense probably damaging 1.00
BB008:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
BB018:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
PIT4810001:Lrrc3b UTSW 14 15358273 missense probably benign 0.17
R0371:Lrrc3b UTSW 14 15358560 nonsense probably null
R1750:Lrrc3b UTSW 14 15358601 missense probably benign 0.00
R4663:Lrrc3b UTSW 14 15358220 missense probably benign 0.01
R4929:Lrrc3b UTSW 14 15357888 missense probably damaging 1.00
R5344:Lrrc3b UTSW 14 15358591 missense probably damaging 1.00
R6537:Lrrc3b UTSW 14 15357946 missense probably damaging 1.00
R7301:Lrrc3b UTSW 14 15357934 missense probably damaging 1.00
R7931:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
R8113:Lrrc3b UTSW 14 15358232 missense probably benign 0.01
R8220:Lrrc3b UTSW 14 15358004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATTCAAGGTGTCTCCGGG -3'
(R):5'- GCATGCATTCAAAGGAGTAGC -3'

Sequencing Primer
(F):5'- AAGGTGTCTCCGGGCATCC -3'
(R):5'- GACCCTGGACTTGTCTGACAAC -3'
Posted On2014-10-16