Mutagenetix > Incidental Mutation

Incidental Mutation 'R2281:Arhgap30'

243091

Institutional Source

Beutler Lab

Gene Symbol

Arhgap30

Ensembl Gene

ENSMUSG00000048865

Gene Name

Rho GTPase activating protein 30

Synonyms

6030405P05Rik

MMRRC Submission

040280-MU

Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171388954-171410298 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 171389328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 21 (D21G)

Ref Sequence

ENSEMBL: ENSMUSP00000059389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000006578

SMART Domains

Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411

Domain	Start	End	E-Value	Type
IG	36	145	9.26e-8	SMART
Pfam:Ig_2	147	241	4e-4	PFAM
Pfam:C2-set_2	150	233	9e-17	PFAM
IGc2	259	321	9.78e-7	SMART
transmembrane domain	348	370	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000056449
AA Change: D21G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: D21G

Domain	Start	End	E-Value	Type
low complexity region	6	14	N/A	INTRINSIC
RhoGAP	31	212	1.4e-61	SMART
Blast:RhoGAP	225	285	2e-24	BLAST
low complexity region	348	366	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
low complexity region	498	510	N/A	INTRINSIC
low complexity region	514	534	N/A	INTRINSIC
low complexity region	667	690	N/A	INTRINSIC
low complexity region	736	752	N/A	INTRINSIC
low complexity region	924	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094325

SMART Domains

Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411

Domain	Start	End	E-Value	Type
IG	36	145	9.26e-8	SMART
Pfam:Ig_2	147	241	2.1e-4	PFAM
Pfam:C2-set_2	150	233	8.7e-17	PFAM
IGc2	259	321	9.78e-7	SMART
transmembrane domain	348	370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111286

SMART Domains

Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411

Domain	Start	End	E-Value	Type
IG	100	209	9.26e-8	SMART
Pfam:C2-set_2	214	297	1.2e-16	PFAM
IGc2	323	385	9.78e-7	SMART
transmembrane domain	412	434	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131607

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194914

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Adgra3	C	T	5: 50,001,880	V343I	probably benign	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3d1	T	C	10: 80,713,998	D771G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Nr3c2	C	A	8: 76,909,907	H546N	probably damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Slc26a5	A	G	5: 21,831,510	I266T	possibly damaging	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Arhgap30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01638:Arhgap30	APN	1	171397570	missense	probably damaging	1.00
IGL02016:Arhgap30	APN	1	171407747	missense	probably damaging	1.00
IGL02552:Arhgap30	APN	1	171407756	missense	probably damaging	1.00
IGL03343:Arhgap30	APN	1	171409094	missense	probably damaging	1.00
consonance	UTSW	1	171404139	critical splice donor site	probably null
deliverance	UTSW	1	171397518	nonsense	probably null
redemption	UTSW	1	171402254	missense	probably damaging	1.00
tercero	UTSW	1	171408341	missense	probably benign
FR4304:Arhgap30	UTSW	1	171405168	small insertion	probably benign
P0017:Arhgap30	UTSW	1	171408704	missense	probably benign	0.02
R0045:Arhgap30	UTSW	1	171408430	missense	probably benign
R0045:Arhgap30	UTSW	1	171408430	missense	probably benign
R0115:Arhgap30	UTSW	1	171407948	missense	possibly damaging	0.92
R0320:Arhgap30	UTSW	1	171403804	missense	possibly damaging	0.81
R0399:Arhgap30	UTSW	1	171404816	missense	probably damaging	0.97
R0945:Arhgap30	UTSW	1	171403286	missense	probably damaging	1.00
R1484:Arhgap30	UTSW	1	171403271	missense	probably damaging	1.00
R1595:Arhgap30	UTSW	1	171408341	missense	probably benign
R2173:Arhgap30	UTSW	1	171407767	missense	probably damaging	1.00
R2864:Arhgap30	UTSW	1	171408206	missense	probably damaging	1.00
R4066:Arhgap30	UTSW	1	171408323	missense	probably benign
R4888:Arhgap30	UTSW	1	171409312	missense	probably benign
R4937:Arhgap30	UTSW	1	171403329	missense	probably benign	0.03
R4944:Arhgap30	UTSW	1	171402254	missense	probably damaging	1.00
R5170:Arhgap30	UTSW	1	171408050	missense	probably benign	0.00
R5218:Arhgap30	UTSW	1	171408760	missense	probably benign
R5385:Arhgap30	UTSW	1	171408280	missense	probably benign
R5541:Arhgap30	UTSW	1	171404139	critical splice donor site	probably null
R6028:Arhgap30	UTSW	1	171408320	missense	probably benign
R6747:Arhgap30	UTSW	1	171407729	missense	probably damaging	1.00
R6748:Arhgap30	UTSW	1	171404810	missense	possibly damaging	0.50
R6869:Arhgap30	UTSW	1	171409055	missense	probably damaging	1.00
R7223:Arhgap30	UTSW	1	171407571	missense	probably damaging	1.00
R8113:Arhgap30	UTSW	1	171397518	nonsense	probably null
R8543:Arhgap30	UTSW	1	171404962	missense	probably damaging	1.00
R8545:Arhgap30	UTSW	1	171407430	missense	probably damaging	1.00
R8682:Arhgap30	UTSW	1	171407402	missense	probably benign	0.00
R8693:Arhgap30	UTSW	1	171397526	missense	probably damaging	1.00
R9026:Arhgap30	UTSW	1	171400690	missense	probably damaging	1.00
R9245:Arhgap30	UTSW	1	171408389	missense	possibly damaging	0.90
R9515:Arhgap30	UTSW	1	171408434	missense	probably benign	0.38
R9524:Arhgap30	UTSW	1	171397546	missense	probably damaging	0.99
X0020:Arhgap30	UTSW	1	171405085	missense	possibly damaging	0.53
Z1177:Arhgap30	UTSW	1	171407908	missense	probably benign	0.01
Z1189:Arhgap30	UTSW	1	171408370	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGCTTCATGCCAGGGTTCTG -3'
(R):5'- AGATCTCAGGTGTGGTGATCC -3'

Sequencing Primer
(F):5'- AAGCGCTGCTGTCCCTTG -3'
(R):5'- TGGTGATCCTGGGCCACTG -3'

Posted On

2014-10-16