Incidental Mutation 'R2281:Arhgap30'
ID243091
Institutional Source Beutler Lab
Gene Symbol Arhgap30
Ensembl Gene ENSMUSG00000048865
Gene NameRho GTPase activating protein 30
Synonyms6030405P05Rik
MMRRC Submission 040280-MU
Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171388954-171410298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171389328 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000059389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect probably benign
Transcript: ENSMUST00000006578
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000056449
AA Change: D21G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: D21G

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094325
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111286
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194914
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Arhgap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Arhgap30 APN 1 171397570 missense probably damaging 1.00
IGL02016:Arhgap30 APN 1 171407747 missense probably damaging 1.00
IGL02552:Arhgap30 APN 1 171407756 missense probably damaging 1.00
IGL03343:Arhgap30 APN 1 171409094 missense probably damaging 1.00
FR4304:Arhgap30 UTSW 1 171405168 small insertion probably benign
P0017:Arhgap30 UTSW 1 171408704 missense probably benign 0.02
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0115:Arhgap30 UTSW 1 171407948 missense possibly damaging 0.92
R0320:Arhgap30 UTSW 1 171403804 missense possibly damaging 0.81
R0399:Arhgap30 UTSW 1 171404816 missense probably damaging 0.97
R0945:Arhgap30 UTSW 1 171403286 missense probably damaging 1.00
R1484:Arhgap30 UTSW 1 171403271 missense probably damaging 1.00
R1595:Arhgap30 UTSW 1 171408341 missense probably benign
R2173:Arhgap30 UTSW 1 171407767 missense probably damaging 1.00
R2864:Arhgap30 UTSW 1 171408206 missense probably damaging 1.00
R4066:Arhgap30 UTSW 1 171408323 missense probably benign
R4888:Arhgap30 UTSW 1 171409312 missense probably benign
R4937:Arhgap30 UTSW 1 171403329 missense probably benign 0.03
R4944:Arhgap30 UTSW 1 171402254 missense probably damaging 1.00
R5170:Arhgap30 UTSW 1 171408050 missense probably benign 0.00
R5218:Arhgap30 UTSW 1 171408760 missense probably benign
R5385:Arhgap30 UTSW 1 171408280 missense probably benign
R5541:Arhgap30 UTSW 1 171404139 critical splice donor site probably null
R6028:Arhgap30 UTSW 1 171408320 missense probably benign
R6747:Arhgap30 UTSW 1 171407729 missense probably damaging 1.00
R6748:Arhgap30 UTSW 1 171404810 missense possibly damaging 0.50
R6869:Arhgap30 UTSW 1 171409055 missense probably damaging 1.00
R7223:Arhgap30 UTSW 1 171407571 missense probably damaging 1.00
X0020:Arhgap30 UTSW 1 171405085 missense possibly damaging 0.53
Z1177:Arhgap30 UTSW 1 171407908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTCATGCCAGGGTTCTG -3'
(R):5'- AGATCTCAGGTGTGGTGATCC -3'

Sequencing Primer
(F):5'- AAGCGCTGCTGTCCCTTG -3'
(R):5'- TGGTGATCCTGGGCCACTG -3'
Posted On2014-10-16