Incidental Mutation 'R2281:4930503B20Rik'
ID243103
Institutional Source Beutler Lab
Gene Symbol 4930503B20Rik
Ensembl Gene ENSMUSG00000090202
Gene NameRIKEN cDNA 4930503B20 gene
Synonyms
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146645193-146651317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146646424 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 228 (L228S)
Ref Sequence ENSEMBL: ENSMUSP00000051453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049703] [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000149825] [ENSMUST00000197989]
Predicted Effect probably damaging
Transcript: ENSMUST00000049703
AA Change: L228S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051453
Gene: ENSMUSG00000090202
AA Change: L228S

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect silent
Transcript: ENSMUST00000124931
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect silent
Transcript: ENSMUST00000125965
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141199
Predicted Effect silent
Transcript: ENSMUST00000147113
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149825
SMART Domains Protein: ENSMUSP00000114745
Gene: ENSMUSG00000090202

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154128
Predicted Effect silent
Transcript: ENSMUST00000197989
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in 4930503B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:4930503B20Rik UTSW 3 146650496 missense probably benign
R1131:4930503B20Rik UTSW 3 146651082 missense probably damaging 1.00
R1523:4930503B20Rik UTSW 3 146651109 missense probably damaging 1.00
R2520:4930503B20Rik UTSW 3 146650506 missense probably damaging 0.99
R3896:4930503B20Rik UTSW 3 146651113 missense possibly damaging 0.88
R4300:4930503B20Rik UTSW 3 146650920 nonsense probably null
R5196:4930503B20Rik UTSW 3 146646263 utr 3 prime probably benign
R5394:4930503B20Rik UTSW 3 146650608 missense probably damaging 1.00
R5394:4930503B20Rik UTSW 3 146650958 missense probably damaging 1.00
R5645:4930503B20Rik UTSW 3 146650509 missense probably damaging 0.98
R5894:4930503B20Rik UTSW 3 146650925 missense probably benign 0.40
R6574:4930503B20Rik UTSW 3 146650858 missense probably benign 0.02
R6830:4930503B20Rik UTSW 3 146650961 missense possibly damaging 0.90
R7604:4930503B20Rik UTSW 3 146650660 nonsense probably null
Z1176:4930503B20Rik UTSW 3 146650956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCCAGTGTGTTTTGACTG -3'
(R):5'- TAGGGTCTTGAAAACAATATCGGC -3'

Sequencing Primer
(F):5'- ACCCAGTGTGTTTTGACTGAGACC -3'
(R):5'- CAATATCGGCTACAAGTTGTGC -3'
Posted On2014-10-16