Incidental Mutation 'R2281:Ptpru'
ID 243107
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Name protein tyrosine phosphatase, receptor type, U
Synonyms Ptprl, RPTPlambda
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2281 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 131768457-131838288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 131808499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 389 (G389V)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
AlphaFold B1AUH1
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: G389V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: G389V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: G317V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: G317V

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: G389V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: G389V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139641
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8355:Ptpru UTSW 4 131808500 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
R8416:Ptpru UTSW 4 131808472 missense probably damaging 1.00
R8858:Ptpru UTSW 4 131799514 splice site probably benign
R8911:Ptpru UTSW 4 131776249 missense probably damaging 0.96
R8934:Ptpru UTSW 4 131818986 missense probably damaging 0.98
R9031:Ptpru UTSW 4 131788380 missense probably damaging 1.00
R9069:Ptpru UTSW 4 131776254 missense possibly damaging 0.87
R9096:Ptpru UTSW 4 131772532 missense probably damaging 1.00
R9097:Ptpru UTSW 4 131772532 missense probably damaging 1.00
R9151:Ptpru UTSW 4 131794967 missense probably benign
R9166:Ptpru UTSW 4 131797869 missense probably benign 0.00
R9174:Ptpru UTSW 4 131808435 missense probably damaging 1.00
R9242:Ptpru UTSW 4 131803030 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGCACGTGGATGTTTCTG -3'
(R):5'- TGCCTTACTCCAGAGCAAATG -3'

Sequencing Primer
(F):5'- CTGAATGGCAGCAGATTCTTG -3'
(R):5'- CCAGAGCAAATGGTATTAGCCTCTTC -3'
Posted On 2014-10-16