Mutagenetix > Incidental Mutations

Incidental Mutation 'R2281:Nphp4'

243113

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

040280-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R2281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152557043 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1094 (K1094E)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056567
AA Change: K1094E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: K1094E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081393
AA Change: K1094E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: K1094E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Adgra3	C	T	5: 50,001,880	V343I	probably benign	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3d1	T	C	10: 80,713,998	D771G	probably damaging	Het
Arhgap30	A	G	1: 171,389,328	D21G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nr3c2	C	A	8: 76,909,907	H546N	probably damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Slc26a5	A	G	5: 21,831,510	I266T	possibly damaging	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1203:Nphp4	UTSW	4	152488832	missense	probably damaging	0.96
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1452:Nphp4	UTSW	4	152547018	missense	probably damaging	0.99
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4084:Nphp4	UTSW	4	152488791	missense	probably damaging	1.00
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4240:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7124:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
R7638:Nphp4	UTSW	4	152554534	missense	probably benign	0.08
R7814:Nphp4	UTSW	4	152524272	missense	possibly damaging	0.93
R7814:Nphp4	UTSW	4	152544403	missense	probably damaging	1.00
R7841:Nphp4	UTSW	4	152496683	missense	probably benign	0.01
R8346:Nphp4	UTSW	4	152561321	missense	probably damaging	1.00
R8479:Nphp4	UTSW	4	152524290	missense	probably benign	0.01
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95
Z1177:Nphp4	UTSW	4	152518196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAGAGCACAGCGATGCTC -3'
(R):5'- AGGGCAATCCATCCATGCTG -3'

Sequencing Primer
(F):5'- AGCACAGCGATGCTCTGGAG -3'
(R):5'- ACTGTCTGGGCACAGCTGAG -3'

Posted On

2014-10-16