Incidental Mutation 'R2281:Plch2'
ID243114
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154984309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1182 (S1182T)
Ref Sequence ENSEMBL: ENSMUSP00000118292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953] [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably benign
Transcript: ENSMUST00000030931
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070953
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105631
AA Change: S1287T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: S1287T

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect probably benign
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 1 77 1.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect probably damaging
Transcript: ENSMUST00000135665
AA Change: S1182T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: S1182T

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139976
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148934
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175982
AA Change: S1035T
Predicted Effect probably benign
Transcript: ENSMUST00000176194
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176620
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTCGTCAGCTGTCAGG -3'
(R):5'- ACGGGCACTGACAGGTTATG -3'

Sequencing Primer
(F):5'- AGGTCTCCCAGACTCTTGGACTTAG -3'
(R):5'- ACAGGGACAGTGTCTCCTCATC -3'
Posted On2014-10-16