Mutagenetix > Incidental Mutations

Incidental Mutation 'R2281:Slc26a5'

243116

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

Pres, prestin

MMRRC Submission

040280-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21810655-21865604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21831510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 266 (I266T)

Ref Sequence

ENSEMBL: ENSMUSP00000110830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

AlphaFold

Q99NH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030878
AA Change: I303T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: I303T

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115176
AA Change: I266T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: I266T

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127975
AA Change: I303T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: I303T

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142888
AA Change: I303T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: I303T

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Adgra3	C	T	5: 50,001,880	V343I	probably benign	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3d1	T	C	10: 80,713,998	D771G	probably damaging	Het
Arhgap30	A	G	1: 171,389,328	D21G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Nr3c2	C	A	8: 76,909,907	H546N	probably damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	21815736	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	21846325	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	21819767	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	21813383	splice site	probably benign
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	21811344	splice site	probably null
R0136:Slc26a5	UTSW	5	21834347	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	21823549	nonsense	probably null
R0522:Slc26a5	UTSW	5	21846345	missense	probably damaging	0.96
R0557:Slc26a5	UTSW	5	21819764	missense	probably damaging	1.00
R0711:Slc26a5	UTSW	5	21847232	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	21816961	missense	probably benign	0.01
R1214:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R1471:Slc26a5	UTSW	5	21816964	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1648:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1861:Slc26a5	UTSW	5	21816958	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	21815727	missense	probably benign	0.03
R2106:Slc26a5	UTSW	5	21823544	missense	probably damaging	1.00
R2169:Slc26a5	UTSW	5	21813865	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	21823478	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	21823547	missense	probably benign	0.39
R2325:Slc26a5	UTSW	5	21819694	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	21847191	missense	probably damaging	1.00
R4793:Slc26a5	UTSW	5	21837994	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	21820386	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	21847196	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	21813901	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	21847260	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	21816976	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	21823563	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	21821097	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	21820350	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	21819719	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	21834344	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	21840572	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	21811336	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	21816974	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	21813894	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	21837246	nonsense	probably null
R7650:Slc26a5	UTSW	5	21834330	missense	possibly damaging	0.96
R8431:Slc26a5	UTSW	5	21813906	missense	probably damaging	1.00
R8812:Slc26a5	UTSW	5	21813882	missense	probably damaging	1.00
R9184:Slc26a5	UTSW	5	21813882	missense	probably damaging	1.00
R9215:Slc26a5	UTSW	5	21837287	missense	possibly damaging	0.93
R9281:Slc26a5	UTSW	5	21814053	missense	probably benign	0.39
R9324:Slc26a5	UTSW	5	21813336	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GCACTGCAGCCTATAAAATCTC -3'
(R):5'- CTTAATGCCTCACCTGGGAAC -3'

Sequencing Primer
(F):5'- AGCCTATAAAATCTCCAGCTGTCTG -3'
(R):5'- AGAAACTGATTCTGGCCTTGAGC -3'

Posted On

2014-10-16