Mutagenetix > Incidental Mutations

Incidental Mutation 'R2281:Adgra3'

243118

Institutional Source

Beutler Lab

Gene Symbol

Adgra3

Ensembl Gene

ENSMUSG00000029090

Gene Name

adhesion G protein-coupled receptor A3

Synonyms

Gpr125, Tem5-like, 3830613O22Rik

MMRRC Submission

040280-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2281 (G1)

Quality Score

185

Status

Not validated

Chromosome

Chromosomal Location

49959956-50059006 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 50001880 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 343 (V343I)

Ref Sequence

ENSEMBL: ENSMUSP00000030971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030971]

Predicted Effect

probably benign
Transcript: ENSMUST00000030971
AA Change: V343I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: V343I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	36	48	N/A	INTRINSIC
LRR	68	92	1.71e1	SMART
LRR_TYP	93	116	2.27e-4	SMART
LRR_TYP	117	140	4.11e-2	SMART
LRR_TYP	141	164	3.89e-3	SMART
LRRCT	176	225	5.24e-5	SMART
IG	238	331	8.26e-5	SMART
GPS	686	738	4.81e-3	SMART
Pfam:7tm_2	746	1031	1.6e-16	PFAM
low complexity region	1251	1262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198818

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3d1	T	C	10: 80,713,998	D771G	probably damaging	Het
Arhgap30	A	G	1: 171,389,328	D21G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Nr3c2	C	A	8: 76,909,907	H546N	probably damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Slc26a5	A	G	5: 21,831,510	I266T	possibly damaging	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Adgra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Adgra3	APN	5	50025758	missense	probably damaging	1.00
IGL00848:Adgra3	APN	5	50001949	missense	probably damaging	1.00
IGL01455:Adgra3	APN	5	49987557	nonsense	probably null
IGL01665:Adgra3	APN	5	50006930	missense	possibly damaging	0.64
IGL02151:Adgra3	APN	5	49979142	missense	probably benign
IGL02239:Adgra3	APN	5	49960712	missense	probably damaging	1.00
IGL02351:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02358:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02938:Adgra3	APN	5	49961317	missense	probably benign	0.01
IGL03028:Adgra3	APN	5	50016852	missense	probably benign	0.30
aperture	UTSW	5	49999145	nonsense	probably null
saltatory	UTSW	5	49960559	missense	probably benign	0.09
ANU74:Adgra3	UTSW	5	49961038	missense	probably benign	0.16
R0041:Adgra3	UTSW	5	49960559	missense	probably benign	0.09
R0121:Adgra3	UTSW	5	50025786	splice site	probably benign
R0125:Adgra3	UTSW	5	50001852	splice site	probably benign
R0137:Adgra3	UTSW	5	49963840	splice site	probably benign
R0415:Adgra3	UTSW	5	49961757	splice site	probably benign
R0479:Adgra3	UTSW	5	49990265	missense	probably benign	0.00
R0505:Adgra3	UTSW	5	50009334	critical splice donor site	probably null
R0831:Adgra3	UTSW	5	49970802	missense	probably damaging	1.00
R0883:Adgra3	UTSW	5	49960723	missense	probably damaging	1.00
R0920:Adgra3	UTSW	5	49961161	missense	probably benign	0.19
R1139:Adgra3	UTSW	5	49961755	splice site	probably null
R1211:Adgra3	UTSW	5	50006876	missense	possibly damaging	0.88
R1370:Adgra3	UTSW	5	49960787	missense	possibly damaging	0.56
R1530:Adgra3	UTSW	5	49961137	missense	probably benign	0.00
R1703:Adgra3	UTSW	5	50006775	missense	probably benign	0.00
R1782:Adgra3	UTSW	5	49972062	missense	probably benign	0.02
R1843:Adgra3	UTSW	5	49961492	missense	probably damaging	1.00
R2157:Adgra3	UTSW	5	50001941	missense	possibly damaging	0.87
R2385:Adgra3	UTSW	5	49979566	missense	possibly damaging	0.95
R2426:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R3084:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3086:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3409:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3410:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3411:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R4301:Adgra3	UTSW	5	49961078	missense	possibly damaging	0.94
R4360:Adgra3	UTSW	5	49990210	missense	possibly damaging	0.92
R4475:Adgra3	UTSW	5	50001898	missense	probably damaging	1.00
R4569:Adgra3	UTSW	5	49960563	missense	probably damaging	1.00
R4607:Adgra3	UTSW	5	49970739	missense	probably damaging	0.98
R4667:Adgra3	UTSW	5	49978956	missense	possibly damaging	0.94
R4671:Adgra3	UTSW	5	49979368	missense	probably damaging	1.00
R4886:Adgra3	UTSW	5	49999195	missense	probably benign	0.07
R5197:Adgra3	UTSW	5	49960754	missense	probably benign	0.01
R5208:Adgra3	UTSW	5	50011515	missense	probably damaging	0.99
R5313:Adgra3	UTSW	5	49961309	missense	probably benign	0.24
R5435:Adgra3	UTSW	5	49990126	missense	probably damaging	0.99
R5663:Adgra3	UTSW	5	49999285	missense	probably benign	0.14
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6064:Adgra3	UTSW	5	49960325	missense	probably damaging	0.97
R6259:Adgra3	UTSW	5	49999141	missense	possibly damaging	0.63
R6272:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R6293:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6296:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6297:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6352:Adgra3	UTSW	5	49979136	missense	probably benign
R6352:Adgra3	UTSW	5	49990250	missense	probably benign	0.01
R6989:Adgra3	UTSW	5	50006884	missense	probably damaging	1.00
R7026:Adgra3	UTSW	5	49960741	missense	probably benign
R7147:Adgra3	UTSW	5	49961245	missense	probably damaging	1.00
R7206:Adgra3	UTSW	5	50006896	missense	probably damaging	1.00
R7381:Adgra3	UTSW	5	50058774	start codon destroyed	probably null
R7508:Adgra3	UTSW	5	50016867	missense	probably benign	0.10
R7538:Adgra3	UTSW	5	49961450	missense	probably benign	0.01
R7579:Adgra3	UTSW	5	49987635	missense	probably benign
R7951:Adgra3	UTSW	5	49963784	missense	probably damaging	1.00
R8269:Adgra3	UTSW	5	49963737	missense	probably damaging	0.98
R8458:Adgra3	UTSW	5	49987671	missense	probably damaging	0.99
R8486:Adgra3	UTSW	5	49990279	missense	probably damaging	0.98
RF005:Adgra3	UTSW	5	50013387	splice site	probably null
RF024:Adgra3	UTSW	5	50013387	splice site	probably null
RF036:Adgra3	UTSW	5	50058641	small deletion	probably benign
X0065:Adgra3	UTSW	5	49971962	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCGGAAAAGTTCAAGCATCTTTG -3'
(R):5'- TATCTTCAGGGTCCCAGTCG -3'

Sequencing Primer
(F):5'- atgGGGACACACACAAAC -3'
(R):5'- GGATCTACTGGAAATTGGGG -3'

Posted On

2014-10-16