Mutagenetix > Incidental Mutations

Incidental Mutation 'R2281:Nr3c2'

243135

Institutional Source

Beutler Lab

Gene Symbol

Nr3c2

Ensembl Gene

ENSMUSG00000031618

Gene Name

nuclear receptor subfamily 3, group C, member 2

Synonyms

MR, aldosterone receptor, mineralocorticoid receptor, Mlr

MMRRC Submission

040280-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76899442-77245012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 76909907 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 546 (H546N)

Ref Sequence

ENSEMBL: ENSMUSP00000118222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]

Predicted Effect

probably benign
Transcript: ENSMUST00000034031
AA Change: H546N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: H546N

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	675	1.89e-31	SMART
low complexity region	690	706	N/A	INTRINSIC
HOLI	771	935	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109911
AA Change: H546N

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: H546N

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
HOLI	658	818	1.1e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109912
AA Change: H546N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: H546N

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109913
AA Change: H546N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: H546N

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128862

Predicted Effect

probably benign
Transcript: ENSMUST00000143284

Predicted Effect

probably damaging
Transcript: ENSMUST00000148106
AA Change: H546N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: H546N

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Adgra3	C	T	5: 50,001,880	V343I	probably benign	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Ap3d1	T	C	10: 80,713,998	D771G	probably damaging	Het
Arhgap30	A	G	1: 171,389,328	D21G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Slc26a5	A	G	5: 21,831,510	I266T	possibly damaging	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Nr3c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00691:Nr3c2	APN	8	76909590	missense	possibly damaging	0.82
IGL01019:Nr3c2	APN	8	76909214	missense	probably damaging	0.99
IGL01085:Nr3c2	APN	8	76908354	missense	probably benign	0.02
IGL01395:Nr3c2	APN	8	76908848	missense	possibly damaging	0.73
IGL01505:Nr3c2	APN	8	76909187	missense	probably damaging	1.00
IGL01656:Nr3c2	APN	8	77187537	missense	probably damaging	1.00
IGL01802:Nr3c2	APN	8	76908595	nonsense	probably null
IGL02147:Nr3c2	APN	8	76909067	missense	probably damaging	0.98
IGL02502:Nr3c2	APN	8	77242514	missense	probably damaging	1.00
IGL02706:Nr3c2	APN	8	76908416	splice site	probably null
IGL02945:Nr3c2	APN	8	76909659	missense	probably damaging	1.00
IGL03034:Nr3c2	APN	8	77187638	nonsense	probably null
IGL03162:Nr3c2	APN	8	77217584	missense	probably damaging	0.99
naughty	UTSW	8	76908668	splice site	probably null
R0141:Nr3c2	UTSW	8	76908408	missense	probably damaging	0.99
R0422:Nr3c2	UTSW	8	77185967	missense	probably benign
R0458:Nr3c2	UTSW	8	76909538	missense	probably damaging	1.00
R0595:Nr3c2	UTSW	8	76909604	missense	possibly damaging	0.93
R0615:Nr3c2	UTSW	8	77185889	missense	probably benign	0.05
R0964:Nr3c2	UTSW	8	76908668	splice site	probably null
R0989:Nr3c2	UTSW	8	77187564	missense	probably damaging	0.97
R1532:Nr3c2	UTSW	8	76909104	missense	probably damaging	0.99
R1624:Nr3c2	UTSW	8	76909944	missense	probably damaging	1.00
R1737:Nr3c2	UTSW	8	76908329	missense	probably benign	0.16
R1965:Nr3c2	UTSW	8	76909463	missense	probably damaging	0.99
R2011:Nr3c2	UTSW	8	76909793	missense	possibly damaging	0.53
R2110:Nr3c2	UTSW	8	76908527	missense	possibly damaging	0.75
R3782:Nr3c2	UTSW	8	77085684	splice site	probably null
R3808:Nr3c2	UTSW	8	76908714	missense	probably damaging	1.00
R4133:Nr3c2	UTSW	8	76909749	missense	probably damaging	1.00
R4433:Nr3c2	UTSW	8	77217467	missense	probably damaging	1.00
R4738:Nr3c2	UTSW	8	76909307	missense	possibly damaging	0.94
R4770:Nr3c2	UTSW	8	76908243	splice site	probably null
R4884:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R5169:Nr3c2	UTSW	8	76909037	missense	probably damaging	1.00
R5347:Nr3c2	UTSW	8	77210748	missense	possibly damaging	0.92
R5857:Nr3c2	UTSW	8	76908867	missense	possibly damaging	0.53
R5878:Nr3c2	UTSW	8	76908268	critical splice acceptor site	probably null
R6262:Nr3c2	UTSW	8	76908633	missense	possibly damaging	0.65
R6547:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R6820:Nr3c2	UTSW	8	77242457	missense	probably damaging	0.98
R7180:Nr3c2	UTSW	8	76908963	missense	probably damaging	0.99
R7672:Nr3c2	UTSW	8	76909209	missense	probably damaging	1.00
R7741:Nr3c2	UTSW	8	77210646	missense	probably damaging	0.97
R7776:Nr3c2	UTSW	8	76909545	missense	possibly damaging	0.77
R7800:Nr3c2	UTSW	8	76909992	missense	probably damaging	1.00
R8742:Nr3c2	UTSW	8	76908581	missense	probably damaging	0.98
R8743:Nr3c2	UTSW	8	76909758	missense	probably damaging	1.00
R8806:Nr3c2	UTSW	8	77242463	missense	probably damaging	1.00
Z1088:Nr3c2	UTSW	8	76908632	missense	possibly damaging	0.48
Z1176:Nr3c2	UTSW	8	76909700	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTGATAGTAGCTGTGAAGGCAG -3'
(R):5'- ACCATGATTTTCAGAGATGGGGC -3'

Sequencing Primer
(F):5'- AAGGCAGTGCGTTCCCG -3'
(R):5'- TTTTCAGAGATGGGGCAGGGAG -3'

Posted On

2014-10-16