Mutagenetix > Incidental Mutations

Incidental Mutation 'R2281:Ap3d1'

243141

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

040280-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R2281 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80713998 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 771 (D771G)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: D771G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: D771G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	G	3: 146,646,424	L228S	probably damaging	Het
Abca13	A	T	11: 9,328,136	K3105N	probably damaging	Het
Abca3	T	A	17: 24,376,726	L351Q	possibly damaging	Het
Acadm	A	G	3: 153,933,043	I231T	possibly damaging	Het
Adamts4	A	T	1: 171,256,229	Q456L	probably damaging	Het
Adgra3	C	T	5: 50,001,880	V343I	probably benign	Het
Ajuba	C	A	14: 54,577,188	G26V	probably damaging	Het
Aldh1a1	A	G	19: 20,620,091	I145M	possibly damaging	Het
Ankrd42	G	A	7: 92,625,773	Q110*	probably null	Het
Ano3	T	A	2: 110,682,759	E630D	probably benign	Het
Arhgap30	A	G	1: 171,389,328	D21G	probably damaging	Het
Atg13	T	C	2: 91,679,425	N374S	probably benign	Het
Ccser1	A	T	6: 61,570,815	M49L	probably damaging	Het
Cdh5	A	G	8: 104,125,733	E160G	probably damaging	Het
Cpd	T	C	11: 76,797,801	K882E	probably benign	Het
Crtac1	G	A	19: 42,283,567	L646F	unknown	Het
Cyp27b1	T	G	10: 127,048,294	V5G	probably damaging	Het
Dcaf11	G	T	14: 55,569,371	*550Y	probably null	Het
Dhx58	A	G	11: 100,698,154		probably null	Het
Dlg2	T	A	7: 92,438,041	I881N	probably damaging	Het
Ece1	C	T	4: 137,946,362	T407M	possibly damaging	Het
Ecsit	C	T	9: 22,076,540	V68I	possibly damaging	Het
Egln1	T	C	8: 124,948,414	D214G	probably benign	Het
Espn	T	C	4: 152,135,545	T47A	possibly damaging	Het
F5	A	G	1: 164,195,720	I1616V	possibly damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fryl	T	C	5: 73,041,364	D2640G	possibly damaging	Het
Gabrg2	T	C	11: 41,976,636	K52R	possibly damaging	Het
Ganab	T	C	19: 8,909,468	V306A	probably damaging	Het
Glod4	A	T	11: 76,237,809	I70N	possibly damaging	Het
Gm8251	T	A	1: 44,056,460	H1826L	possibly damaging	Het
Gsn	T	A	2: 35,283,918	V2E	probably benign	Het
Hist1h1c	A	G	13: 23,738,924	K26E	probably benign	Het
Hrg	C	T	16: 22,961,309		probably benign	Het
Kctd19	T	C	8: 105,387,266	T592A	probably benign	Het
Kdm3b	A	G	18: 34,808,419	D521G	probably damaging	Het
Lrba	A	G	3: 86,776,103	H2744R	possibly damaging	Het
Lsr	C	T	7: 30,958,345	A397T	probably damaging	Het
Methig1	A	T	15: 100,353,360	M51L	possibly damaging	Het
Mga	A	G	2: 119,903,723	I351V	probably benign	Het
Mlf1	G	A	3: 67,399,751	V250I	possibly damaging	Het
Mreg	A	T	1: 72,192,064	N78K	probably damaging	Het
Mtor	A	G	4: 148,489,555	D1294G	probably benign	Het
Nfkb1	T	C	3: 135,601,521	I548V	probably damaging	Het
Nlrp3	T	C	11: 59,549,136	F513S	possibly damaging	Het
Nphp4	A	G	4: 152,557,043	K1094E	possibly damaging	Het
Nr3c2	C	A	8: 76,909,907	H546N	probably damaging	Het
Nr4a2	T	A	2: 57,112,199	M18L	probably benign	Het
Olfr1214	G	A	2: 88,987,470	T244I	probably benign	Het
Olfr1392	A	C	11: 49,293,632	T104P	probably benign	Het
Pclo	A	G	5: 14,540,332	N882S	unknown	Het
Pde6a	T	C	18: 61,262,434	Y583H	probably damaging	Het
Pip5k1b	T	A	19: 24,378,947	Y209F	probably damaging	Het
Plch2	A	T	4: 154,984,309	S1182T	probably damaging	Het
Ptger2	G	T	14: 44,989,650	R229L	probably damaging	Het
Ptpru	C	A	4: 131,808,499	G389V	probably damaging	Het
Ric8a	A	G	7: 140,861,938	N249S	probably benign	Het
Slc26a5	A	G	5: 21,831,510	I266T	possibly damaging	Het
Smyd1	T	C	6: 71,238,676	N100D	probably damaging	Het
Stag3	T	C	5: 138,298,284	F468S	probably damaging	Het
Stk31	C	T	6: 49,417,250	T182I	probably damaging	Het
Svep1	G	T	4: 58,082,677	N1982K	possibly damaging	Het
Thegl	T	C	5: 77,059,367	I324T	probably damaging	Het
Tinagl1	A	G	4: 130,166,993	Y344H	probably damaging	Het
Tmem216	T	A	19: 10,551,873	T104S	probably damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Ube4b	A	G	4: 149,344,572	I870T	probably damaging	Het
Vwa8	T	A	14: 79,064,996	L1035Q	possibly damaging	Het
Wdr35	A	G	12: 8,978,628	Q82R	probably benign	Het
Wnk1	A	T	6: 119,963,640		probably null	Het
Zc3h7a	T	C	16: 11,158,594		probably benign	Het
Zfp532	T	C	18: 65,624,712	V572A	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGAGTGGAGTAAAATACTGCCC -3'
(R):5'- GCTCTAAGCTCATAGTCAGGACC -3'

Sequencing Primer
(F):5'- CATCATGGAGGGCTTGTGCAAC -3'
(R):5'- CTAAGCTCATAGTCAGGACCTGATG -3'

Posted On

2014-10-16