Incidental Mutation 'R2281:Nlrp3'
ID243147
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene NameNLR family, pyrin domain containing 3
SynonymsCias1, cryopyrin, Pypaf1, NALP3, Mmig1
MMRRC Submission 040280-MU
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59541568-59566956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59549136 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 513 (F513S)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: F513S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: F513S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: F513S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: F513S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59548446 missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59548086 missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59565066 missense probably benign 0.00
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGGCATTGAGGAGCATCTCTTC -3'
(R):5'- CTGGTTTACAAGGCCAAAGAGG -3'

Sequencing Primer
(F):5'- TCTCTGACTACCTACAGGGGC -3'
(R):5'- TTTACAAGGCCAAAGAGGAATCG -3'
Posted On2014-10-16