Incidental Mutation 'R2281:Nlrp3'
ID 243147
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 040280-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R2281 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59439962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 513 (F513S)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: F513S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: F513S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: F513S

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: F513S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,352,179 (GRCm39) L228S probably damaging Het
Abca13 A T 11: 9,278,136 (GRCm39) K3105N probably damaging Het
Abca3 T A 17: 24,595,700 (GRCm39) L351Q possibly damaging Het
Acadm A G 3: 153,638,680 (GRCm39) I231T possibly damaging Het
Adamts4 A T 1: 171,083,798 (GRCm39) Q456L probably damaging Het
Adgra3 C T 5: 50,159,222 (GRCm39) V343I probably benign Het
Ajuba C A 14: 54,814,645 (GRCm39) G26V probably damaging Het
Aldh1a1 A G 19: 20,597,455 (GRCm39) I145M possibly damaging Het
Ankrd42 G A 7: 92,274,981 (GRCm39) Q110* probably null Het
Ano3 T A 2: 110,513,104 (GRCm39) E630D probably benign Het
Ap3d1 T C 10: 80,549,832 (GRCm39) D771G probably damaging Het
Arhgap30 A G 1: 171,216,896 (GRCm39) D21G probably damaging Het
Atg13 T C 2: 91,509,770 (GRCm39) N374S probably benign Het
Ccdc168 T A 1: 44,095,620 (GRCm39) H1826L possibly damaging Het
Ccser1 A T 6: 61,547,799 (GRCm39) M49L probably damaging Het
Cdh5 A G 8: 104,852,365 (GRCm39) E160G probably damaging Het
Cpd T C 11: 76,688,627 (GRCm39) K882E probably benign Het
Crtac1 G A 19: 42,272,006 (GRCm39) L646F unknown Het
Cyp27b1 T G 10: 126,884,163 (GRCm39) V5G probably damaging Het
Dcaf11 G T 14: 55,806,828 (GRCm39) *550Y probably null Het
Dhx58 A G 11: 100,588,980 (GRCm39) probably null Het
Dlg2 T A 7: 92,087,249 (GRCm39) I881N probably damaging Het
Ece1 C T 4: 137,673,673 (GRCm39) T407M possibly damaging Het
Ecsit C T 9: 21,987,836 (GRCm39) V68I possibly damaging Het
Egln1 T C 8: 125,675,153 (GRCm39) D214G probably benign Het
Espn T C 4: 152,220,002 (GRCm39) T47A possibly damaging Het
F5 A G 1: 164,023,289 (GRCm39) I1616V possibly damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Fryl T C 5: 73,198,707 (GRCm39) D2640G possibly damaging Het
Gabrg2 T C 11: 41,867,463 (GRCm39) K52R possibly damaging Het
Ganab T C 19: 8,886,832 (GRCm39) V306A probably damaging Het
Glod4 A T 11: 76,128,635 (GRCm39) I70N possibly damaging Het
Gsn T A 2: 35,173,930 (GRCm39) V2E probably benign Het
H1f2 A G 13: 23,922,907 (GRCm39) K26E probably benign Het
Hrg C T 16: 22,780,059 (GRCm39) probably benign Het
Kctd19 T C 8: 106,113,898 (GRCm39) T592A probably benign Het
Kdm3b A G 18: 34,941,472 (GRCm39) D521G probably damaging Het
Lrba A G 3: 86,683,410 (GRCm39) H2744R possibly damaging Het
Lsr C T 7: 30,657,770 (GRCm39) A397T probably damaging Het
Methig1 A T 15: 100,251,241 (GRCm39) M51L possibly damaging Het
Mga A G 2: 119,734,204 (GRCm39) I351V probably benign Het
Mlf1 G A 3: 67,307,084 (GRCm39) V250I possibly damaging Het
Mreg A T 1: 72,231,223 (GRCm39) N78K probably damaging Het
Mtor A G 4: 148,574,012 (GRCm39) D1294G probably benign Het
Nfkb1 T C 3: 135,307,282 (GRCm39) I548V probably damaging Het
Nphp4 A G 4: 152,641,500 (GRCm39) K1094E possibly damaging Het
Nr3c2 C A 8: 77,636,536 (GRCm39) H546N probably damaging Het
Nr4a2 T A 2: 57,002,211 (GRCm39) M18L probably benign Het
Or2y1f A C 11: 49,184,459 (GRCm39) T104P probably benign Het
Or4c109 G A 2: 88,817,814 (GRCm39) T244I probably benign Het
Pclo A G 5: 14,590,346 (GRCm39) N882S unknown Het
Pde6a T C 18: 61,395,505 (GRCm39) Y583H probably damaging Het
Pip5k1b T A 19: 24,356,311 (GRCm39) Y209F probably damaging Het
Plch2 A T 4: 155,068,766 (GRCm39) S1182T probably damaging Het
Ptger2 G T 14: 45,227,107 (GRCm39) R229L probably damaging Het
Ptpru C A 4: 131,535,810 (GRCm39) G389V probably damaging Het
Ric8a A G 7: 140,441,851 (GRCm39) N249S probably benign Het
Slc26a5 A G 5: 22,036,508 (GRCm39) I266T possibly damaging Het
Smyd1 T C 6: 71,215,660 (GRCm39) N100D probably damaging Het
Spmap2l T C 5: 77,207,214 (GRCm39) I324T probably damaging Het
Stag3 T C 5: 138,296,546 (GRCm39) F468S probably damaging Het
Stk31 C T 6: 49,394,184 (GRCm39) T182I probably damaging Het
Svep1 G T 4: 58,082,677 (GRCm39) N1982K possibly damaging Het
Tinagl1 A G 4: 130,060,786 (GRCm39) Y344H probably damaging Het
Tmem216 T A 19: 10,529,237 (GRCm39) T104S probably damaging Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Ube4b A G 4: 149,429,029 (GRCm39) I870T probably damaging Het
Vwa8 T A 14: 79,302,436 (GRCm39) L1035Q possibly damaging Het
Wdr35 A G 12: 9,028,628 (GRCm39) Q82R probably benign Het
Wnk1 A T 6: 119,940,601 (GRCm39) probably null Het
Zc3h7a T C 16: 10,976,458 (GRCm39) probably benign Het
Zfp532 T C 18: 65,757,783 (GRCm39) V572A probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGGCATTGAGGAGCATCTCTTC -3'
(R):5'- CTGGTTTACAAGGCCAAAGAGG -3'

Sequencing Primer
(F):5'- TCTCTGACTACCTACAGGGGC -3'
(R):5'- TTTACAAGGCCAAAGAGGAATCG -3'
Posted On 2014-10-16