Incidental Mutation 'R2281:Glod4'
ID243148
Institutional Source Beutler Lab
Gene Symbol Glod4
Ensembl Gene ENSMUSG00000017286
Gene Nameglyoxalase domain containing 4
Synonyms1700082G03Rik, 2700085E05Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76120987-76243725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76237809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 70 (I70N)
Ref Sequence ENSEMBL: ENSMUSP00000131788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017430] [ENSMUST00000168055] [ENSMUST00000169701] [ENSMUST00000170017] [ENSMUST00000170590] [ENSMUST00000170710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017430
AA Change: I89N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017430
Gene: ENSMUSG00000017286
AA Change: I89N

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 1.1e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164022
AA Change: I66N
SMART Domains Protein: ENSMUSP00000126699
Gene: ENSMUSG00000017286
AA Change: I66N

DomainStartEndE-ValueType
PDB:3ZI1|A 2 212 1e-143 PDB
SCOP:d1mpya1 119 198 4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167883
Predicted Effect possibly damaging
Transcript: ENSMUST00000168055
AA Change: I66N

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130675
Gene: ENSMUSG00000017286
AA Change: I66N

DomainStartEndE-ValueType
PDB:3ZI1|A 2 98 3e-61 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect possibly damaging
Transcript: ENSMUST00000169701
AA Change: I89N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286
AA Change: I89N

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170017
SMART Domains Protein: ENSMUSP00000132496
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
SCOP:d1qipa_ 1 40 3e-5 SMART
PDB:3ZI1|A 1 47 4e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170590
AA Change: S49T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129009
Gene: ENSMUSG00000017286
AA Change: S49T

DomainStartEndE-ValueType
PDB:3ZI1|A 1 47 2e-23 PDB
SCOP:d1mpya2 1 66 1e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170710
AA Change: I70N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131788
Gene: ENSMUSG00000017286
AA Change: I70N

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 124 237 6.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Glod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Glod4 APN 11 76233278 missense probably benign 0.08
IGL01099:Glod4 APN 11 76239550 nonsense probably null
IGL01761:Glod4 APN 11 76243602 missense probably benign 0.00
FR4548:Glod4 UTSW 11 76243310 start gained probably benign
R1354:Glod4 UTSW 11 76237828 splice site probably null
R1386:Glod4 UTSW 11 76222003 nonsense probably null
R1791:Glod4 UTSW 11 76237708 missense probably damaging 1.00
R2484:Glod4 UTSW 11 76239518 missense probably damaging 1.00
R4515:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4517:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4519:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R5945:Glod4 UTSW 11 76234471 missense probably damaging 1.00
R6471:Glod4 UTSW 11 76233918 missense probably damaging 1.00
R6488:Glod4 UTSW 11 76237785 missense probably damaging 0.96
R6976:Glod4 UTSW 11 76243580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAATACAGAAAATTCCACGGCAG -3'
(R):5'- CTGATTTATAAATGCCTGCATCTGG -3'

Sequencing Primer
(F):5'- ATCCCATCTTAATCAAATGTGCC -3'
(R):5'- CCTGCATCTGGAGAATTTGAAG -3'
Posted On2014-10-16