Incidental Mutation 'R2281:Wdr35'
ID243152
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8978628 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 82 (Q82R)
Ref Sequence ENSEMBL: ENSMUSP00000124285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000160329]
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: Q82R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: Q82R

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: Q82R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: Q82R

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159126
Predicted Effect probably benign
Transcript: ENSMUST00000160329
AA Change: Q82R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124285
Gene: ENSMUSG00000066643
AA Change: Q82R

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
low complexity region 172 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R7940:Wdr35 UTSW 12 9008113 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATGGAACAGGATTTTGCACTG -3'
(R):5'- ATTCTTAGCATGACTCTCACATTCG -3'

Sequencing Primer
(F):5'- GACTGACAATGCACAAAGT -3'
(R):5'- GCATGACTCTCACATTCGTAGAGAG -3'
Posted On2014-10-16