Incidental Mutation 'R2281:Dcaf11'
ID243156
Institutional Source Beutler Lab
Gene Symbol Dcaf11
Ensembl Gene ENSMUSG00000022214
Gene NameDDB1 and CUL4 associated factor 11
Synonyms0710008A13Rik, GLO14, D14Ucla1, Wdr23
MMRRC Submission 040280-MU
Accession Numbers

Genbank: NM_133734; MGI: 90168

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55560006-55570065 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) G to T at 55569371 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 550 (*550Y)
Ref Sequence ENSEMBL: ENSMUSP00000114211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072530] [ENSMUST00000117236] [ENSMUST00000117701] [ENSMUST00000121622] [ENSMUST00000128490] [ENSMUST00000143375] [ENSMUST00000150019] [ENSMUST00000150481] [ENSMUST00000152681]
Predicted Effect probably null
Transcript: ENSMUST00000072530
AA Change: *550Y
SMART Domains Protein: ENSMUSP00000072344
Gene: ENSMUSG00000022214
AA Change: *550Y

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117236
AA Change: *550Y
SMART Domains Protein: ENSMUSP00000113014
Gene: ENSMUSG00000022214
AA Change: *550Y

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117701
AA Change: *510Y
SMART Domains Protein: ENSMUSP00000113620
Gene: ENSMUSG00000022214
AA Change: *510Y

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WD40 122 160 8.91e-1 SMART
WD40 165 206 8.25e0 SMART
WD40 212 253 2.39e0 SMART
WD40 256 296 1.44e-5 SMART
WD40 304 343 1.26e-5 SMART
WD40 384 429 1.72e0 SMART
WD40 432 471 1.49e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121622
AA Change: *550Y
SMART Domains Protein: ENSMUSP00000113202
Gene: ENSMUSG00000022214
AA Change: *550Y

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128490
AA Change: *550Y
SMART Domains Protein: ENSMUSP00000114211
Gene: ENSMUSG00000022214
AA Change: *550Y

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000143375
SMART Domains Protein: ENSMUSP00000121570
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145983
Predicted Effect probably benign
Transcript: ENSMUST00000150019
SMART Domains Protein: ENSMUSP00000117617
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150481
SMART Domains Protein: ENSMUSP00000119001
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152681
SMART Domains Protein: ENSMUSP00000120296
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155029
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Dcaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Dcaf11 APN 14 55561285 utr 5 prime probably benign
IGL02158:Dcaf11 APN 14 55564523 splice site probably null
IGL02487:Dcaf11 APN 14 55569114 missense probably benign 0.06
IGL02887:Dcaf11 APN 14 55564135 missense probably damaging 1.00
IGL03263:Dcaf11 APN 14 55565492 missense probably damaging 0.99
IGL03392:Dcaf11 APN 14 55561421 missense probably damaging 1.00
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0084:Dcaf11 UTSW 14 55569243 missense probably benign 0.00
R0110:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0450:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0510:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0662:Dcaf11 UTSW 14 55565507 missense possibly damaging 0.93
R1087:Dcaf11 UTSW 14 55569124 missense probably damaging 0.96
R2698:Dcaf11 UTSW 14 55566885 missense probably damaging 1.00
R2866:Dcaf11 UTSW 14 55565745 missense possibly damaging 0.92
R4472:Dcaf11 UTSW 14 55565606 intron probably benign
R5288:Dcaf11 UTSW 14 55563376 missense probably damaging 1.00
R5682:Dcaf11 UTSW 14 55563426 missense probably damaging 1.00
R5706:Dcaf11 UTSW 14 55565695 missense probably damaging 1.00
R7133:Dcaf11 UTSW 14 55568926 intron probably null
R7468:Dcaf11 UTSW 14 55565509 missense possibly damaging 0.70
R7673:Dcaf11 UTSW 14 55569305 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACGGCTTGTGTCTAGAG -3'
(R):5'- ATGCACGAGGAAACCACTTG -3'

Sequencing Primer
(F):5'- CTTGTGTCTAGAGCTGGGAC -3'
(R):5'- GAAACCACTTGGCCCAGTTTG -3'
Posted On2014-10-16