Incidental Mutation 'R2281:Zc3h7a'
ID243160
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Namezinc finger CCCH type containing 7 A
SynonymsZc3h7, A430104C18Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11136592-11176393 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 11158594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000125537] [ENSMUST00000128083] [ENSMUST00000128083] [ENSMUST00000130355] [ENSMUST00000130355] [ENSMUST00000138185] [ENSMUST00000138185] [ENSMUST00000140755] [ENSMUST00000142389]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125537
SMART Domains Protein: ENSMUSP00000122525
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128083
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128083
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130355
SMART Domains Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 4.4e-9 PFAM
Blast:TPR 124 156 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130355
SMART Domains Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 4.4e-9 PFAM
Blast:TPR 124 156 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138185
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138185
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140755
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142389
SMART Domains Protein: ENSMUSP00000114432
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
agreement UTSW 16 11153161 missense probably benign 0.02
Clement UTSW 16 11164602 nonsense probably null
consensus UTSW 16 11161026 missense probably damaging 1.00
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 11156202 missense probably benign 0.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R0831:Zc3h7a UTSW 16 11151880 missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 11158973 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 11147370 missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 11149224 missense probably benign 0.00
R7354:Zc3h7a UTSW 16 11148514 missense probably damaging 1.00
R7667:Zc3h7a UTSW 16 11139026 nonsense probably null
R7742:Zc3h7a UTSW 16 11153161 missense probably benign 0.02
R7780:Zc3h7a UTSW 16 11149251 missense probably benign 0.26
R8228:Zc3h7a UTSW 16 11139090 missense probably damaging 1.00
R8302:Zc3h7a UTSW 16 11137385 missense probably damaging 1.00
R8309:Zc3h7a UTSW 16 11146553 intron probably benign
R8795:Zc3h7a UTSW 16 11147283 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTACAGATAATAACCCTGCCTTG -3'
(R):5'- TGTTGCTCTTTCCAGGATGAAC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CATATGTTAGAGCTGAGGTAAG -3'
Posted On2014-10-16