Incidental Mutation 'R2281:Kdm3b'
ID 243164
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene Name KDM3B lysine (K)-specific demethylase 3B
Synonyms JHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock # R2281 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34777047-34838660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34808419 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 521 (D521G)
Ref Sequence ENSEMBL: ENSMUSP00000037628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000224715] [ENSMUST00000225195]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: D521G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: D521G

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180512
Predicted Effect probably benign
Transcript: ENSMUST00000224715
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: D321G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225260
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
Affable UTSW 18 34793005 missense probably damaging 1.00
Dotage UTSW 18 34827382 missense probably damaging 1.00
Endearing UTSW 18 34827328 splice site probably null
Oldtimer UTSW 18 34823699 nonsense probably null
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1558:Kdm3b UTSW 18 34809096 missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34828469 missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34819873 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
R7488:Kdm3b UTSW 18 34824881 missense probably damaging 0.97
R7587:Kdm3b UTSW 18 34797027 splice site probably null
R7695:Kdm3b UTSW 18 34794559 missense possibly damaging 0.86
R7846:Kdm3b UTSW 18 34809240 missense possibly damaging 0.94
R7984:Kdm3b UTSW 18 34823699 nonsense probably null
R7997:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R8035:Kdm3b UTSW 18 34808728 missense probably damaging 1.00
R8064:Kdm3b UTSW 18 34813407 critical splice acceptor site probably null
R8141:Kdm3b UTSW 18 34828546 nonsense probably null
R8302:Kdm3b UTSW 18 34834335 missense probably damaging 1.00
R8328:Kdm3b UTSW 18 34793070 missense probably damaging 1.00
R8443:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8513:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8515:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8523:Kdm3b UTSW 18 34793076 missense probably benign 0.04
R8717:Kdm3b UTSW 18 34819787 missense probably damaging 0.98
R8725:Kdm3b UTSW 18 34827382 missense probably damaging 1.00
R8727:Kdm3b UTSW 18 34827382 missense probably damaging 1.00
R8762:Kdm3b UTSW 18 34804104 missense probably benign
R8835:Kdm3b UTSW 18 34808749 missense probably damaging 1.00
R8918:Kdm3b UTSW 18 34837597 missense probably damaging 1.00
R9015:Kdm3b UTSW 18 34830159 missense probably damaging 1.00
R9144:Kdm3b UTSW 18 34794505 missense probably benign
R9246:Kdm3b UTSW 18 34808427 nonsense probably null
R9376:Kdm3b UTSW 18 34837665 missense probably damaging 0.99
X0028:Kdm3b UTSW 18 34799266 splice site probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Z1176:Kdm3b UTSW 18 34809069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAATTCTAGTCTGGCCTCTTCTG -3'
(R):5'- TCTGCAGGCACTTTTCGGTC -3'

Sequencing Primer
(F):5'- CTGGATTTGGAGTGTCTCTCTCAAG -3'
(R):5'- CTGAGTATCTGCTCCGAGAACAG -3'
Posted On 2014-10-16