Incidental Mutation 'R2282:Snx5'
ID243176
Institutional Source Beutler Lab
Gene Symbol Snx5
Ensembl Gene ENSMUSG00000027423
Gene Namesorting nexin 5
SynonymsD2Ertd52e, 0910001N05Rik, 1810032P22Rik
MMRRC Submission 040281-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2282 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144250123-144270906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144253675 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 355 (E355D)
Ref Sequence ENSEMBL: ENSMUSP00000105657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028909] [ENSMUST00000110030]
Predicted Effect probably benign
Transcript: ENSMUST00000028909
AA Change: E355D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423
AA Change: E355D

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110030
AA Change: E355D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423
AA Change: E355D

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 1.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156936
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein functions in endosomal sorting, the phosphoinositide-signaling pathway, and macropinocytosis. This gene may play a role in the tumorigenesis of papillary thyroid carcinoma. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired alveolar epithelial differentiation of type I cells, respiratory failure and lethality during the perinatal and postnatal periods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A G 18: 65,307,626 L232P probably benign Het
Ap5b1 A T 19: 5,569,637 T362S possibly damaging Het
Ash2l A G 8: 25,835,042 M163T probably damaging Het
Atp13a5 T C 16: 29,237,321 Y1029C probably damaging Het
Baz1a G T 12: 54,916,812 S829* probably null Het
Cd1d2 A G 3: 86,987,251 K109E probably benign Het
Col4a3 T C 1: 82,708,638 F1309L unknown Het
Dnah5 A T 15: 28,327,302 E2055V probably damaging Het
Epha5 A T 5: 84,150,410 I542N probably damaging Het
Gm8300 A T 12: 87,517,317 I141F unknown Het
Hectd1 A T 12: 51,769,008 V1432D possibly damaging Het
Klf12 C T 14: 99,900,145 E322K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1386 T G 11: 49,470,643 M164R probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr729 A G 14: 50,148,319 V185A probably benign Het
Olfr894 A G 9: 38,218,828 M2V probably benign Het
Pde6b A G 5: 108,423,586 probably null Het
Pdzd2 C T 15: 12,373,848 G2067D possibly damaging Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Smg5 A G 3: 88,345,398 M164V probably benign Het
Tmbim6 T C 15: 99,404,526 F93S probably damaging Het
Trp53bp1 G A 2: 121,270,273 Q77* probably null Het
Ttn A G 2: 76,799,538 V14216A possibly damaging Het
Vmn2r68 C T 7: 85,221,651 C808Y possibly damaging Het
Wnt10b A G 15: 98,774,221 F205S probably damaging Het
Other mutations in Snx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Snx5 APN 2 144255565 missense probably benign
IGL01739:Snx5 APN 2 144270405 missense probably benign 0.00
IGL03394:Snx5 APN 2 144253754 missense probably damaging 1.00
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0344:Snx5 UTSW 2 144257208 splice site probably benign
R0848:Snx5 UTSW 2 144253806 missense probably damaging 0.98
R1440:Snx5 UTSW 2 144254811 missense possibly damaging 0.90
R3830:Snx5 UTSW 2 144254901 critical splice donor site probably null
R5727:Snx5 UTSW 2 144260754 missense probably benign 0.00
R6048:Snx5 UTSW 2 144259153 missense probably damaging 0.97
R7497:Snx5 UTSW 2 144257974 missense probably damaging 0.99
R7664:Snx5 UTSW 2 144258004 splice site probably null
R7895:Snx5 UTSW 2 144253820 missense possibly damaging 0.90
R8098:Snx5 UTSW 2 144255562 missense probably benign 0.00
Z1088:Snx5 UTSW 2 144252491 missense probably benign 0.29
Z1177:Snx5 UTSW 2 144259079 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGCTCAGATAAGCCGAC -3'
(R):5'- GTGTACGCAATAGAGACACATGC -3'

Sequencing Primer
(F):5'- TGCTCAGATAAGCCGACTCTCC -3'
(R):5'- TAGAGACACATGCATATGCCTAG -3'
Posted On2014-10-16