Incidental Mutation 'R2282:S100a1'
ID243179
Institutional Source Beutler Lab
Gene Symbol S100a1
Ensembl Gene ENSMUSG00000044080
Gene NameS100 calcium binding protein A1
SynonymsS100a, S100
MMRRC Submission 040281-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2282 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90511034-90514392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90511292 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 72 (F72L)
Ref Sequence ENSEMBL: ENSMUSP00000058237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001043] [ENSMUST00000048138] [ENSMUST00000049937] [ENSMUST00000060738] [ENSMUST00000076639] [ENSMUST00000107340] [ENSMUST00000107342] [ENSMUST00000107343] [ENSMUST00000107344] [ENSMUST00000107346] [ENSMUST00000131868] [ENSMUST00000146740]
Predicted Effect probably benign
Transcript: ENSMUST00000001043
SMART Domains Protein: ENSMUSP00000001043
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048138
SMART Domains Protein: ENSMUSP00000047737
Gene: ENSMUSG00000042312

DomainStartEndE-ValueType
Pfam:S_100 71 113 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049937
SMART Domains Protein: ENSMUSP00000061800
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
FoP_duplication 158 246 3.35e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060738
AA Change: F72L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058237
Gene: ENSMUSG00000044080
AA Change: F72L

DomainStartEndE-ValueType
Pfam:S_100 5 47 5.8e-23 PFAM
Pfam:EF-hand_1 54 82 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076639
SMART Domains Protein: ENSMUSP00000075936
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
Blast:FoP_duplication 59 84 3e-6 BLAST
low complexity region 86 108 N/A INTRINSIC
FoP_duplication 114 199 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107340
SMART Domains Protein: ENSMUSP00000102963
Gene: ENSMUSG00000044080

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107342
SMART Domains Protein: ENSMUSP00000102965
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Blast:FoP_duplication 34 59 3e-6 BLAST
low complexity region 61 83 N/A INTRINSIC
FoP_duplication 89 174 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107343
SMART Domains Protein: ENSMUSP00000102966
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
FoP_duplication 90 175 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107344
SMART Domains Protein: ENSMUSP00000102967
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107346
SMART Domains Protein: ENSMUSP00000102969
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
FoP_duplication 115 200 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131868
SMART Domains Protein: ENSMUSP00000123448
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146740
SMART Domains Protein: ENSMUSP00000116945
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 139 159 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous and heterozygous mice exhibit a reduced cardiac contractility in response to chronic hemodynamic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A G 18: 65,307,626 L232P probably benign Het
Ap5b1 A T 19: 5,569,637 T362S possibly damaging Het
Ash2l A G 8: 25,835,042 M163T probably damaging Het
Atp13a5 T C 16: 29,237,321 Y1029C probably damaging Het
Baz1a G T 12: 54,916,812 S829* probably null Het
Cd1d2 A G 3: 86,987,251 K109E probably benign Het
Col4a3 T C 1: 82,708,638 F1309L unknown Het
Dnah5 A T 15: 28,327,302 E2055V probably damaging Het
Epha5 A T 5: 84,150,410 I542N probably damaging Het
Gm8300 A T 12: 87,517,317 I141F unknown Het
Hectd1 A T 12: 51,769,008 V1432D possibly damaging Het
Klf12 C T 14: 99,900,145 E322K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1386 T G 11: 49,470,643 M164R probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr729 A G 14: 50,148,319 V185A probably benign Het
Olfr894 A G 9: 38,218,828 M2V probably benign Het
Pde6b A G 5: 108,423,586 probably null Het
Pdzd2 C T 15: 12,373,848 G2067D possibly damaging Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Smg5 A G 3: 88,345,398 M164V probably benign Het
Snx5 T A 2: 144,253,675 E355D probably benign Het
Tmbim6 T C 15: 99,404,526 F93S probably damaging Het
Trp53bp1 G A 2: 121,270,273 Q77* probably null Het
Ttn A G 2: 76,799,538 V14216A possibly damaging Het
Vmn2r68 C T 7: 85,221,651 C808Y possibly damaging Het
Wnt10b A G 15: 98,774,221 F205S probably damaging Het
Other mutations in S100a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1061:S100a1 UTSW 3 90511312 missense probably damaging 0.96
R1183:S100a1 UTSW 3 90511334 missense probably benign
R1766:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R4615:S100a1 UTSW 3 90511255 missense possibly damaging 0.63
R5397:S100a1 UTSW 3 90512135 start codon destroyed probably null 1.00
R7852:S100a1 UTSW 3 90512085 missense probably benign
R7935:S100a1 UTSW 3 90512085 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGGACTGCCACTCTTGTG -3'
(R):5'- CAGTCTTTAAGGTTGTAGAAGACTCCC -3'

Sequencing Primer
(F):5'- TTGGTGCACGTCGAGAC -3'
(R):5'- GTGGCTCTGACTTAGTGA -3'
Posted On2014-10-16