Mutagenetix > Incidental Mutations

Incidental Mutation 'R2282:Rfx2'

243198

Institutional Source

Beutler Lab

Gene Symbol

Rfx2

Ensembl Gene

ENSMUSG00000024206

Gene Name

regulatory factor X, 2 (influences HLA class II expression)

Synonyms

5430432H19Rik

MMRRC Submission

040281-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.728) question?

Stock #

R2282 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56775897-56831008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56803722 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 88 (Y88C)

Ref Sequence

ENSEMBL: ENSMUSP00000084010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002444
AA Change: Y88C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: Y88C

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	149	1.9e-50	PFAM
Pfam:RFX_DNA_binding	192	269	4.3e-36	PFAM
Blast:HisKA	479	542	1e-31	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000086801
AA Change: Y88C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: Y88C

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	151	6.8e-56	PFAM
Pfam:RFX_DNA_binding	161	246	6e-41	PFAM
Blast:HisKA	454	517	1e-31	BLAST

Meta Mutation Damage Score

0.4904

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	A	G	18: 65,307,626	L232P	probably benign	Het
Ap5b1	A	T	19: 5,569,637	T362S	possibly damaging	Het
Ash2l	A	G	8: 25,835,042	M163T	probably damaging	Het
Atp13a5	T	C	16: 29,237,321	Y1029C	probably damaging	Het
Baz1a	G	T	12: 54,916,812	S829*	probably null	Het
Cd1d2	A	G	3: 86,987,251	K109E	probably benign	Het
Col4a3	T	C	1: 82,708,638	F1309L	unknown	Het
Dnah5	A	T	15: 28,327,302	E2055V	probably damaging	Het
Epha5	A	T	5: 84,150,410	I542N	probably damaging	Het
Gm8300	A	T	12: 87,517,317	I141F	unknown	Het
Hectd1	A	T	12: 51,769,008	V1432D	possibly damaging	Het
Klf12	C	T	14: 99,900,145	E322K	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Olfr1386	T	G	11: 49,470,643	M164R	probably damaging	Het
Olfr339	G	A	2: 36,422,000	V201I	probably benign	Het
Olfr729	A	G	14: 50,148,319	V185A	probably benign	Het
Olfr894	A	G	9: 38,218,828	M2V	probably benign	Het
Pde6b	A	G	5: 108,423,586		probably null	Het
Pdzd2	C	T	15: 12,373,848	G2067D	possibly damaging	Het
S100a1	A	G	3: 90,511,292	F72L	probably damaging	Het
Smg5	A	G	3: 88,345,398	M164V	probably benign	Het
Snx5	T	A	2: 144,253,675	E355D	probably benign	Het
Tmbim6	T	C	15: 99,404,526	F93S	probably damaging	Het
Trp53bp1	G	A	2: 121,270,273	Q77*	probably null	Het
Ttn	A	G	2: 76,799,538	V14216A	possibly damaging	Het
Vmn2r68	C	T	7: 85,221,651	C808Y	possibly damaging	Het
Wnt10b	A	G	15: 98,774,221	F205S	probably damaging	Het

Other mutations in Rfx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Rfx2	APN	17	56783657	missense	probably damaging	1.00
IGL01296:Rfx2	APN	17	56808317	start codon destroyed	possibly damaging	0.81
IGL01488:Rfx2	APN	17	56805398	missense	probably damaging	1.00
IGL01705:Rfx2	APN	17	56785303	missense	possibly damaging	0.88
IGL02389:Rfx2	APN	17	56808325	splice site	probably benign
IGL02601:Rfx2	APN	17	56785354	missense	possibly damaging	0.75
IGL02609:Rfx2	APN	17	56805404	missense	probably benign	0.00
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0197:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R0370:Rfx2	UTSW	17	56799308	missense	probably benign	0.03
R0413:Rfx2	UTSW	17	56784418	splice site	probably benign
R0622:Rfx2	UTSW	17	56777071	missense	probably damaging	0.99
R0883:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R1429:Rfx2	UTSW	17	56804369	missense	probably damaging	0.97
R1439:Rfx2	UTSW	17	56787720	missense	probably damaging	1.00
R1569:Rfx2	UTSW	17	56804326	missense	possibly damaging	0.63
R1654:Rfx2	UTSW	17	56808263	missense	probably benign	0.00
R1751:Rfx2	UTSW	17	56784754	missense	probably benign	0.01
R1816:Rfx2	UTSW	17	56808305	nonsense	probably null
R3408:Rfx2	UTSW	17	56803526	missense	probably benign	0.00
R3962:Rfx2	UTSW	17	56785302	missense	probably damaging	0.99
R4415:Rfx2	UTSW	17	56787733	missense	possibly damaging	0.95
R4876:Rfx2	UTSW	17	56784706	missense	probably benign	0.00
R4883:Rfx2	UTSW	17	56783747	missense	probably damaging	0.98
R5588:Rfx2	UTSW	17	56779890	missense	possibly damaging	0.69
R5766:Rfx2	UTSW	17	56803587	missense	probably benign	0.02
R5798:Rfx2	UTSW	17	56804362	missense	possibly damaging	0.89
R5931:Rfx2	UTSW	17	56780778	missense	probably damaging	0.99
R6061:Rfx2	UTSW	17	56777473	missense	possibly damaging	0.86
R6466:Rfx2	UTSW	17	56784397	missense	probably benign	0.13
R6800:Rfx2	UTSW	17	56780804	missense	probably damaging	0.99
R7329:Rfx2	UTSW	17	56803681	missense	probably benign	0.05
R7476:Rfx2	UTSW	17	56803527	missense	probably benign	0.31
R8159:Rfx2	UTSW	17	56803605	missense	probably benign	0.43
R8274:Rfx2	UTSW	17	56804348	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGGATGAGGTAGGCTCCTG -3'
(R):5'- CAGACCTTTGAGTTTCCTGGAC -3'

Sequencing Primer
(F):5'- TGCGCCAGACACAATGG -3'
(R):5'- GAGTTTCCTGGACTGTTGACAAAAC -3'

Posted On

2014-10-16