Incidental Mutation 'R2283:Ppa1'
ID243218
Institutional Source Beutler Lab
Gene Symbol Ppa1
Ensembl Gene ENSMUSG00000020089
Gene Namepyrophosphatase (inorganic) 1
SynonymsPyp, 2010317E03Rik
MMRRC Submission 040282-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2283 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location61648552-61674168 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 61661009 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 92 (W92*)
Ref Sequence ENSEMBL: ENSMUSP00000020286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020286]
Predicted Effect probably null
Transcript: ENSMUST00000020286
AA Change: W92*
SMART Domains Protein: ENSMUSP00000020286
Gene: ENSMUSG00000020089
AA Change: W92*

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 46 228 2.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the inorganic pyrophosphatase (PPase) family. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Studies of a similar protein in bovine suggested a cytoplasmic localization of this enzyme. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,377,891 E1235G probably damaging Het
Anapc1 A T 2: 128,642,548 H1165Q probably benign Het
Bhmt G A 13: 93,620,301 P273L probably damaging Het
Clec18a A G 8: 111,075,508 V283A probably benign Het
Dlg5 G A 14: 24,158,663 P825L probably benign Het
Fas G A 19: 34,307,249 G52D probably damaging Het
Fras1 T C 5: 96,654,305 I1209T probably benign Het
Gpt2 T A 8: 85,516,189 D283E probably benign Het
Hrh1 C T 6: 114,480,439 T227I probably benign Het
Kif26a T C 12: 112,177,353 F1347S possibly damaging Het
Krt2 T C 15: 101,814,387 Y392C probably damaging Het
Masp2 A G 4: 148,606,068 K261E probably benign Het
Nav2 G T 7: 49,491,404 R899L probably damaging Het
Nuggc T C 14: 65,638,612 V574A possibly damaging Het
Olfr11 G A 13: 21,639,020 R168C probably damaging Het
Pcsk4 T C 10: 80,322,750 E556G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sp3 A C 2: 72,971,177 I164S possibly damaging Het
St8sia3 G T 18: 64,271,730 E359D probably damaging Het
Usp17lb A G 7: 104,840,652 I355T possibly damaging Het
Zfp608 T A 18: 54,988,374 K47I probably damaging Het
Zfp931 A G 2: 178,069,921 V11A possibly damaging Het
Other mutations in Ppa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Ppa1 APN 10 61665436 missense probably benign 0.12
IGL02489:Ppa1 APN 10 61665444 missense probably damaging 0.99
hotpot UTSW 10 61666970 missense probably damaging 1.00
R0635:Ppa1 UTSW 10 61665440 missense probably benign 0.02
R0635:Ppa1 UTSW 10 61666970 missense probably damaging 1.00
R1925:Ppa1 UTSW 10 61651609 nonsense probably null
R2394:Ppa1 UTSW 10 61672384 splice site probably benign
R6180:Ppa1 UTSW 10 61667652 missense probably benign
R6823:Ppa1 UTSW 10 61667603 missense probably damaging 1.00
R6893:Ppa1 UTSW 10 61672403 missense probably benign 0.00
R6999:Ppa1 UTSW 10 61661017 missense probably damaging 1.00
R7298:Ppa1 UTSW 10 61666912 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCACCATGTCAGGGATGAAAC -3'
(R):5'- TCTGTGAAGAATGTACAGTCGGG -3'

Sequencing Primer
(F):5'- CCATGTCAGGGATGAAACAAATCCTG -3'
(R):5'- TACAGTCGGGAGTCTAAAATGAGTC -3'
Posted On2014-10-16