Incidental Mutation 'R2283:Kif26a'
ID243221
Institutional Source Beutler Lab
Gene Symbol Kif26a
Ensembl Gene ENSMUSG00000021294
Gene Namekinesin family member 26A
SynonymsN-11 kinesin
MMRRC Submission 040282-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R2283 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112146208-112181747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112177353 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1347 (F1347S)
Ref Sequence ENSEMBL: ENSMUSP00000119482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000128402
AA Change: F1347S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: F1347S

DomainStartEndE-ValueType
low complexity region 238 248 N/A INTRINSIC
low complexity region 279 297 N/A INTRINSIC
KISc 362 726 9.57e-35 SMART
low complexity region 727 739 N/A INTRINSIC
low complexity region 740 754 N/A INTRINSIC
low complexity region 932 957 N/A INTRINSIC
low complexity region 1005 1012 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1328 1360 N/A INTRINSIC
low complexity region 1458 1471 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1519 1538 N/A INTRINSIC
low complexity region 1574 1587 N/A INTRINSIC
low complexity region 1664 1675 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
coiled coil region 1780 1812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183816
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,377,891 E1235G probably damaging Het
Anapc1 A T 2: 128,642,548 H1165Q probably benign Het
Bhmt G A 13: 93,620,301 P273L probably damaging Het
Clec18a A G 8: 111,075,508 V283A probably benign Het
Dlg5 G A 14: 24,158,663 P825L probably benign Het
Fas G A 19: 34,307,249 G52D probably damaging Het
Fras1 T C 5: 96,654,305 I1209T probably benign Het
Gpt2 T A 8: 85,516,189 D283E probably benign Het
Hrh1 C T 6: 114,480,439 T227I probably benign Het
Krt2 T C 15: 101,814,387 Y392C probably damaging Het
Masp2 A G 4: 148,606,068 K261E probably benign Het
Nav2 G T 7: 49,491,404 R899L probably damaging Het
Nuggc T C 14: 65,638,612 V574A possibly damaging Het
Olfr11 G A 13: 21,639,020 R168C probably damaging Het
Pcsk4 T C 10: 80,322,750 E556G probably damaging Het
Ppa1 G A 10: 61,661,009 W92* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sp3 A C 2: 72,971,177 I164S possibly damaging Het
St8sia3 G T 18: 64,271,730 E359D probably damaging Het
Usp17lb A G 7: 104,840,652 I355T possibly damaging Het
Zfp608 T A 18: 54,988,374 K47I probably damaging Het
Zfp931 A G 2: 178,069,921 V11A possibly damaging Het
Other mutations in Kif26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Kif26a APN 12 112157632 missense probably damaging 0.97
IGL01734:Kif26a APN 12 112176828 missense probably benign 0.23
IGL01916:Kif26a APN 12 112176894 missense possibly damaging 0.49
IGL02080:Kif26a APN 12 112157566 missense probably damaging 1.00
IGL02138:Kif26a APN 12 112174850 missense probably damaging 1.00
IGL02145:Kif26a APN 12 112176975 missense probably benign 0.00
IGL02285:Kif26a APN 12 112157507 missense probably damaging 1.00
IGL02393:Kif26a APN 12 112172664 missense probably damaging 1.00
IGL02445:Kif26a APN 12 112173743 missense probably damaging 1.00
IGL02865:Kif26a APN 12 112177615 nonsense probably null
IGL03057:Kif26a APN 12 112175774 nonsense probably null
IGL03204:Kif26a APN 12 112174779 missense probably damaging 1.00
R0013:Kif26a UTSW 12 112177880 missense probably benign 0.03
R0034:Kif26a UTSW 12 112168963 splice site probably benign
R0089:Kif26a UTSW 12 112177403 missense probably damaging 0.98
R0111:Kif26a UTSW 12 112163337 splice site probably benign
R0220:Kif26a UTSW 12 112157390 missense probably damaging 0.98
R0346:Kif26a UTSW 12 112179348 missense probably null 0.09
R0383:Kif26a UTSW 12 112178076 missense possibly damaging 0.94
R0478:Kif26a UTSW 12 112175789 missense probably damaging 1.00
R0494:Kif26a UTSW 12 112179471 splice site probably null
R1163:Kif26a UTSW 12 112179945 missense probably benign 0.08
R1450:Kif26a UTSW 12 112173852 missense probably damaging 1.00
R1512:Kif26a UTSW 12 112146955 missense possibly damaging 0.47
R1616:Kif26a UTSW 12 112157246 critical splice acceptor site probably null
R1723:Kif26a UTSW 12 112173858 missense possibly damaging 0.67
R1728:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1729:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1903:Kif26a UTSW 12 112175540 missense probably damaging 1.00
R3862:Kif26a UTSW 12 112179889 missense probably benign 0.30
R3906:Kif26a UTSW 12 112176890 missense probably benign
R4050:Kif26a UTSW 12 112179916 missense probably benign 0.08
R4270:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4271:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4731:Kif26a UTSW 12 112175573 missense probably benign
R4732:Kif26a UTSW 12 112175573 missense probably benign
R4733:Kif26a UTSW 12 112175573 missense probably benign
R4908:Kif26a UTSW 12 112157342 missense probably damaging 1.00
R4946:Kif26a UTSW 12 112177794 missense probably damaging 0.99
R5566:Kif26a UTSW 12 112157354 missense probably damaging 1.00
R6280:Kif26a UTSW 12 112174869 missense probably damaging 0.99
R6422:Kif26a UTSW 12 112168875 missense possibly damaging 0.95
R6513:Kif26a UTSW 12 112175492 missense probably damaging 0.97
R6860:Kif26a UTSW 12 112146829 missense probably damaging 1.00
R6879:Kif26a UTSW 12 112177653 missense probably benign
R7127:Kif26a UTSW 12 112178145 missense probably damaging 1.00
R7366:Kif26a UTSW 12 112163542 critical splice donor site probably null
R7595:Kif26a UTSW 12 112179325 missense probably benign 0.30
R7630:Kif26a UTSW 12 112175697 missense probably damaging 1.00
R7784:Kif26a UTSW 12 112178147 missense possibly damaging 0.66
X0027:Kif26a UTSW 12 112176070 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGATGATGCTGGCTTGTGC -3'
(R):5'- GAGGAATCAGACCGACCACTAG -3'

Sequencing Primer
(F):5'- TGGCATCCAGAATGTCGC -3'
(R):5'- ACCACTAGGCCTGGCTTC -3'
Posted On2014-10-16