Incidental Mutation 'R2284:Olfr1157'
ID243235
Institutional Source Beutler Lab
Gene Symbol Olfr1157
Ensembl Gene ENSMUSG00000075143
Gene Nameolfactory receptor 1157
SynonymsMOR174-1, GA_x6K02T2Q125-49446395-49445457
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87958485-87968299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87962793 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 33 (L33P)
Ref Sequence ENSEMBL: ENSMUSP00000097429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099841]
Predicted Effect probably damaging
Transcript: ENSMUST00000099841
AA Change: L33P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097429
Gene: ENSMUSG00000075143
AA Change: L33P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.7e-48 PFAM
Pfam:7tm_1 41 290 2.6e-20 PFAM
Meta Mutation Damage Score 0.4148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Olfr1157
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Olfr1157 UTSW 2 87962458 missense possibly damaging 0.90
R1502:Olfr1157 UTSW 2 87962035 missense probably damaging 1.00
R2127:Olfr1157 UTSW 2 87962832 missense probably benign 0.01
R2443:Olfr1157 UTSW 2 87962865 missense possibly damaging 0.47
R4021:Olfr1157 UTSW 2 87962722 missense possibly damaging 0.77
R4693:Olfr1157 UTSW 2 87962709 missense probably benign 0.39
R4752:Olfr1157 UTSW 2 87962349 missense probably damaging 1.00
R4879:Olfr1157 UTSW 2 87962696 missense possibly damaging 0.91
R4983:Olfr1157 UTSW 2 87962698 missense probably benign 0.26
R5592:Olfr1157 UTSW 2 87962340 missense probably damaging 1.00
R5945:Olfr1157 UTSW 2 87962602 missense probably damaging 1.00
R6412:Olfr1157 UTSW 2 87962349 missense probably damaging 1.00
R7470:Olfr1157 UTSW 2 87962449 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GACCATACATGCCAGGGATG -3'
(R):5'- AGATGTATACTACACCCTACCATCTG -3'

Sequencing Primer
(F):5'- CCATACATGCCAGGGATGATATG -3'
(R):5'- CCTACCATCTGAGAAGAGTTTAAAC -3'
Posted On2014-10-16