Incidental Mutation 'R2284:Vmn1r67'
ID243242
Institutional Source Beutler Lab
Gene Symbol Vmn1r67
Ensembl Gene ENSMUSG00000046716
Gene Namevomeronasal 1 receptor 67
SynonymsV1re10
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10443331-10449202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10447673 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 288 (H288L)
Ref Sequence ENSEMBL: ENSMUSP00000060746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055964] [ENSMUST00000226237]
Predicted Effect probably damaging
Transcript: ENSMUST00000055964
AA Change: H288L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060746
Gene: ENSMUSG00000046716
AA Change: H288L

DomainStartEndE-ValueType
Pfam:V1R 34 292 4.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226237
AA Change: H227L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Vmn1r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Vmn1r67 APN 7 10446840 missense possibly damaging 0.96
IGL02812:Vmn1r67 APN 7 10447018 missense probably benign 0.01
IGL03121:Vmn1r67 APN 7 10447467 missense probably benign 0.00
IGL03208:Vmn1r67 APN 7 10447098 missense possibly damaging 0.94
PIT4142001:Vmn1r67 UTSW 7 10446950 missense probably benign 0.13
R0048:Vmn1r67 UTSW 7 10446866 missense probably damaging 1.00
R0549:Vmn1r67 UTSW 7 10447714 missense probably damaging 1.00
R1595:Vmn1r67 UTSW 7 10447670 missense probably benign 0.18
R1608:Vmn1r67 UTSW 7 10446980 missense possibly damaging 0.82
R3614:Vmn1r67 UTSW 7 10447429 missense probably damaging 0.98
R4399:Vmn1r67 UTSW 7 10447549 missense possibly damaging 0.89
R4542:Vmn1r67 UTSW 7 10447430 missense probably damaging 0.99
R5216:Vmn1r67 UTSW 7 10447163 missense probably benign 0.00
R5655:Vmn1r67 UTSW 7 10447388 missense probably benign 0.43
R5837:Vmn1r67 UTSW 7 10447022 missense probably benign 0.26
R6526:Vmn1r67 UTSW 7 10447671 missense probably benign 0.05
R6735:Vmn1r67 UTSW 7 10447211 missense probably damaging 1.00
R6846:Vmn1r67 UTSW 7 10446913 missense probably benign 0.04
R7086:Vmn1r67 UTSW 7 10447117 missense possibly damaging 0.93
R7227:Vmn1r67 UTSW 7 10447548 nonsense probably null
R7594:Vmn1r67 UTSW 7 10447415 missense possibly damaging 0.95
R7608:Vmn1r67 UTSW 7 10447363 missense possibly damaging 0.89
R7797:Vmn1r67 UTSW 7 10446976 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGAATCCAGAGCCACTCAGAAG -3'
(R):5'- GTGAGCTCATGTAGGCTTCAAC -3'

Sequencing Primer
(F):5'- ACTCAGAAGATCCTAGTCCTGGTG -3'
(R):5'- CCTTTTGATGAAGAGTGTGA -3'
Posted On2014-10-16