Incidental Mutation 'R2284:Ptpre'
ID243243
Institutional Source Beutler Lab
Gene Symbol Ptpre
Ensembl Gene ENSMUSG00000041836
Gene Nameprotein tyrosine phosphatase, receptor type, E
SynonymsPTPe, RPTPepsilon, PTPepsilon
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R2284 (G1)
Quality Score148
Status Validated
Chromosome7
Chromosomal Location135537481-135686293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135669781 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 375 (H375R)
Ref Sequence ENSEMBL: ENSMUSP00000147656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]
Predicted Effect probably benign
Transcript: ENSMUST00000073961
AA Change: H355R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: H355R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
PTPc 133 395 4.65e-136 SMART
PTPc 424 690 7.36e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209256
AA Change: H375R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000209979
AA Change: H298R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210833
AA Change: H355R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211092
Predicted Effect probably benign
Transcript: ENSMUST00000211140
AA Change: H355R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000211788
AA Change: H368R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Ptpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Ptpre APN 7 135659053 missense probably damaging 0.98
IGL01019:Ptpre APN 7 135678325 nonsense probably null
IGL01115:Ptpre APN 7 135670764 missense probably damaging 1.00
IGL01456:Ptpre APN 7 135669802 missense probably damaging 1.00
IGL01516:Ptpre APN 7 135664999 missense probably damaging 0.97
IGL02108:Ptpre APN 7 135659102 missense possibly damaging 0.85
IGL02735:Ptpre APN 7 135667567 missense probably damaging 1.00
IGL03326:Ptpre APN 7 135672817 missense probably damaging 1.00
IGL03327:Ptpre APN 7 135672822 critical splice donor site probably null
R0183:Ptpre UTSW 7 135669845 missense probably benign 0.01
R0369:Ptpre UTSW 7 135670715 missense probably damaging 1.00
R0538:Ptpre UTSW 7 135663315 missense probably damaging 0.99
R0762:Ptpre UTSW 7 135679235 missense probably damaging 0.99
R1169:Ptpre UTSW 7 135667612 missense probably benign 0.33
R1214:Ptpre UTSW 7 135679258 missense probably damaging 1.00
R1629:Ptpre UTSW 7 135669799 missense probably damaging 1.00
R1654:Ptpre UTSW 7 135653928 missense probably benign 0.32
R1819:Ptpre UTSW 7 135668993 splice site probably benign
R1876:Ptpre UTSW 7 135678317 missense possibly damaging 0.73
R2049:Ptpre UTSW 7 135670695 splice site probably benign
R2895:Ptpre UTSW 7 135643858 nonsense probably null
R4508:Ptpre UTSW 7 135669103 missense probably damaging 1.00
R4603:Ptpre UTSW 7 135667643 nonsense probably null
R4644:Ptpre UTSW 7 135651932 intron probably benign
R4863:Ptpre UTSW 7 135669132 missense probably benign 0.00
R4989:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5015:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5133:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5134:Ptpre UTSW 7 135652092 missense probably damaging 0.96
R5291:Ptpre UTSW 7 135678301 missense probably benign
R5372:Ptpre UTSW 7 135653940 missense possibly damaging 0.87
R5653:Ptpre UTSW 7 135653943 missense probably damaging 0.99
R5896:Ptpre UTSW 7 135674278 missense probably benign 0.39
R6238:Ptpre UTSW 7 135671180 missense probably damaging 1.00
R6974:Ptpre UTSW 7 135669148 missense possibly damaging 0.95
R7125:Ptpre UTSW 7 135654015 nonsense probably null
R7298:Ptpre UTSW 7 135683287 missense probably damaging 1.00
R7453:Ptpre UTSW 7 135538074 missense unknown
R7459:Ptpre UTSW 7 135667600 missense probably benign
R7855:Ptpre UTSW 7 135651995 missense probably benign
R7938:Ptpre UTSW 7 135651995 missense probably benign
R8003:Ptpre UTSW 7 135669036 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCCTCTAGTGGCTATGCATAG -3'
(R):5'- TGACAGACCAGGTGCAAAAC -3'

Sequencing Primer
(F):5'- CCCTCTAGTGGCTATGCATAGATTTG -3'
(R):5'- GACCAGGTGCAAAACAACAAC -3'
Posted On2014-10-16