Incidental Mutation 'R2284:Gldn'
ID243247
Institutional Source Beutler Lab
Gene Symbol Gldn
Ensembl Gene ENSMUSG00000046167
Gene Namegliomedin
SynonymsCRG-L2, Crlg2
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2284 (G1)
Quality Score111
Status Validated
Chromosome9
Chromosomal Location54286486-54341786 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 54286565 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 14 (W14*)
Ref Sequence ENSEMBL: ENSMUSP00000056080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056740]
Predicted Effect probably null
Transcript: ENSMUST00000056740
AA Change: W14*
SMART Domains Protein: ENSMUSP00000056080
Gene: ENSMUSG00000046167
AA Change: W14*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Collagen 136 195 8.3e-11 PFAM
low complexity region 199 211 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
OLF 299 543 1.97e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149237
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele fail to form heminodes without overt neurological abnormalities or alteration in nerve conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Gldn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gldn APN 9 54338464 missense probably damaging 0.99
IGL01778:Gldn APN 9 54334492 splice site probably null
IGL02425:Gldn APN 9 54338721 missense probably damaging 1.00
R2902:Gldn UTSW 9 54335814 missense possibly damaging 0.84
R3055:Gldn UTSW 9 54338523 missense probably damaging 0.96
R3683:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3684:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3733:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3734:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R4668:Gldn UTSW 9 54332018 nonsense probably null
R5228:Gldn UTSW 9 54334719 missense probably damaging 0.98
R5574:Gldn UTSW 9 54312922 missense probably damaging 1.00
R5773:Gldn UTSW 9 54334491 critical splice donor site probably null
R5926:Gldn UTSW 9 54338438 missense possibly damaging 0.68
R5943:Gldn UTSW 9 54338437 missense possibly damaging 0.81
R6331:Gldn UTSW 9 54286878 missense probably benign 0.32
R6671:Gldn UTSW 9 54338407 missense probably damaging 1.00
R6821:Gldn UTSW 9 54338770 missense probably benign 0.01
R6897:Gldn UTSW 9 54334874 splice site probably null
R7579:Gldn UTSW 9 54338364 missense probably benign 0.21
R7604:Gldn UTSW 9 54338593 missense probably benign
R7705:Gldn UTSW 9 54338692 missense probably benign 0.00
Z1177:Gldn UTSW 9 54286660 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACGGGTCTAAAGACAGCCTG -3'
(R):5'- CACCATGGAGTAGGTCATCATC -3'

Sequencing Primer
(F):5'- GGGTCTAAAGACAGCCTGACTCAC -3'
(R):5'- CCATGGAGTAGGTCATCATCATCATC -3'
Posted On2014-10-16