Incidental Mutation 'R2284:Ccdc36'
ID243248
Institutional Source Beutler Lab
Gene Symbol Ccdc36
Ensembl Gene ENSMUSG00000047220
Gene Namecoiled-coil domain containing 36
Synonyms
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108403611-108428484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108421473 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 49 (E49K)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592]
Predicted Effect probably damaging
Transcript: ENSMUST00000076592
AA Change: E49K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: E49K

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Meta Mutation Damage Score 0.4538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Ccdc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Ccdc36 APN 9 108417319 splice site probably benign
IGL02138:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02305:Ccdc36 APN 9 108405832 missense possibly damaging 0.82
IGL02456:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02936:Ccdc36 APN 9 108412503 missense possibly damaging 0.69
IGL03150:Ccdc36 APN 9 108404956 missense probably damaging 0.98
IGL03163:Ccdc36 APN 9 108404933 missense probably benign 0.00
IGL03280:Ccdc36 APN 9 108404900 missense possibly damaging 0.92
R0139:Ccdc36 UTSW 9 108412496 missense probably damaging 1.00
R0276:Ccdc36 UTSW 9 108428440 missense possibly damaging 0.84
R0744:Ccdc36 UTSW 9 108404801 missense probably benign
R0836:Ccdc36 UTSW 9 108404801 missense probably benign
R1792:Ccdc36 UTSW 9 108404912 missense possibly damaging 0.84
R1918:Ccdc36 UTSW 9 108412985 missense probably benign 0.16
R2401:Ccdc36 UTSW 9 108413006 missense possibly damaging 0.53
R4731:Ccdc36 UTSW 9 108405385 missense probably benign 0.00
R4819:Ccdc36 UTSW 9 108406678 missense probably benign 0.10
R4950:Ccdc36 UTSW 9 108421510 missense probably damaging 1.00
R4968:Ccdc36 UTSW 9 108412514 missense probably benign 0.11
R7131:Ccdc36 UTSW 9 108417420 missense probably benign 0.01
R7201:Ccdc36 UTSW 9 108404775 missense probably damaging 0.98
R7950:Ccdc36 UTSW 9 108405671 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGCACAAACCCATTTAGGATAG -3'
(R):5'- ATCTTCTGAAGTCGTAGCTGTG -3'

Sequencing Primer
(F):5'- CTGTAATTCCAACAATCAGGAGGCTG -3'
(R):5'- AAGTCGTAGCTGTGAGTTATGAG -3'
Posted On2014-10-16