Incidental Mutation 'R2284:Hhatl'
ID243249
Institutional Source Beutler Lab
Gene Symbol Hhatl
Ensembl Gene ENSMUSG00000032523
Gene Namehedgehog acyltransferase-like
SynonymsGup1, 1110011D13Rik
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121784016-121792507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121789582 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 118 (Y118C)
Ref Sequence ENSEMBL: ENSMUSP00000149486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000163981] [ENSMUST00000214768] [ENSMUST00000215477] [ENSMUST00000215910] [ENSMUST00000217652]
Predicted Effect probably damaging
Transcript: ENSMUST00000035110
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523
AA Change: Y118C

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163981
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523
AA Change: Y118C

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214768
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215477
Predicted Effect probably benign
Transcript: ENSMUST00000215910
Predicted Effect probably benign
Transcript: ENSMUST00000217652
Meta Mutation Damage Score 0.3678 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Hhatl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Hhatl APN 9 121789791 missense probably benign 0.21
R0270:Hhatl UTSW 9 121784720 missense probably benign 0.14
R0399:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0417:Hhatl UTSW 9 121788762 missense probably benign 0.00
R0436:Hhatl UTSW 9 121788762 missense probably benign 0.00
R1741:Hhatl UTSW 9 121789059 missense possibly damaging 0.67
R2250:Hhatl UTSW 9 121788171 missense possibly damaging 0.67
R2513:Hhatl UTSW 9 121789170 missense probably benign 0.13
R4278:Hhatl UTSW 9 121784219 missense probably benign
R4717:Hhatl UTSW 9 121789877 missense probably damaging 1.00
R4851:Hhatl UTSW 9 121789011 missense probably damaging 1.00
R5759:Hhatl UTSW 9 121788277 missense probably damaging 1.00
R6330:Hhatl UTSW 9 121788225 unclassified probably null
R6387:Hhatl UTSW 9 121790401 missense probably benign 0.09
R6460:Hhatl UTSW 9 121789522 missense probably benign 0.32
R6541:Hhatl UTSW 9 121785144 missense probably damaging 1.00
R6651:Hhatl UTSW 9 121784702 missense probably damaging 1.00
R6670:Hhatl UTSW 9 121789071 missense probably damaging 0.96
R6914:Hhatl UTSW 9 121788180 missense probably benign
R6942:Hhatl UTSW 9 121788180 missense probably benign
R7026:Hhatl UTSW 9 121788273 missense probably benign 0.26
R7251:Hhatl UTSW 9 121785050 critical splice donor site probably null
R7323:Hhatl UTSW 9 121789586 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGGGTCTCGGCACTATC -3'
(R):5'- GCTGTTTGCCAAACTCTGCAC -3'

Sequencing Primer
(F):5'- GGTCTCGGCACTATCCCCAC -3'
(R):5'- TTGCCAAACTCTGCACGATGG -3'
Posted On2014-10-16