Incidental Mutation 'R2284:Dip2a'
ID243251
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76313193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 247 (V247G)
Ref Sequence ENSEMBL: ENSMUSP00000101057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048]
Predicted Effect probably benign
Transcript: ENSMUST00000036033
AA Change: V247G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: V247G

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105417
AA Change: V247G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: V247G

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160048
AA Change: V208G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: V208G

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162766
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGTGGCCTAATTCCCCTC -3'
(R):5'- TGAATAGAAACTCACTGCCTGC -3'

Sequencing Primer
(F):5'- GCTGTCTATGATAACATTCACTGCAC -3'
(R):5'- ACTGCCTGCTGAATTAATCACTG -3'
Posted On2014-10-16