Incidental Mutation 'R2284:Csl'
ID243252
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99758459 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 248 (D248V)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056085
AA Change: D248V

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: D248V

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222959
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2882:Csl UTSW 10 99758925 missense probably damaging 1.00
R4128:Csl UTSW 10 99758600 missense probably benign 0.02
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R5700:Csl UTSW 10 99759015 missense probably damaging 0.97
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8064:Csl UTSW 10 99758545 missense probably damaging 1.00
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
R8696:Csl UTSW 10 99758964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCATCTTCGCCAACTTC -3'
(R):5'- CCGAACTAAGTACTGGGAGCTC -3'

Sequencing Primer
(F):5'- GACAAGCACCTCCTGATTTGCTAG -3'
(R):5'- CTAAGTACTGGGAGCTCACCTATG -3'
Posted On2014-10-16