Incidental Mutation 'R2284:Krtap31-1'
ID243257
Institutional Source Beutler Lab
Gene Symbol Krtap31-1
Ensembl Gene ENSMUSG00000070334
Gene Namekeratin associated protein 31-1
Synonyms
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R2284 (G1)
Quality Score138
Status Validated
Chromosome11
Chromosomal Location99907920-99908892 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 99908255 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 95 (Q95*)
Ref Sequence ENSEMBL: ENSMUSP00000091467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093935]
Predicted Effect probably null
Transcript: ENSMUST00000093935
AA Change: Q95*
SMART Domains Protein: ENSMUSP00000091467
Gene: ENSMUSG00000070334
AA Change: Q95*

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 40 56 N/A INTRINSIC
Pfam:Keratin_B2_2 64 107 1.9e-9 PFAM
Pfam:Keratin_B2_2 111 157 2.4e-6 PFAM
Meta Mutation Damage Score 0.9689 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Krtap31-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1608:Krtap31-1 UTSW 11 99908093 missense probably benign 0.18
R2343:Krtap31-1 UTSW 11 99908021 missense possibly damaging 0.86
R4072:Krtap31-1 UTSW 11 99908232 missense possibly damaging 0.52
R4074:Krtap31-1 UTSW 11 99908232 missense possibly damaging 0.52
R4076:Krtap31-1 UTSW 11 99908232 missense possibly damaging 0.52
R4086:Krtap31-1 UTSW 11 99908319 missense possibly damaging 0.93
R4884:Krtap31-1 UTSW 11 99908484 missense unknown
R7644:Krtap31-1 UTSW 11 99908222 missense possibly damaging 0.71
R7670:Krtap31-1 UTSW 11 99908432 missense not run
R7897:Krtap31-1 UTSW 11 99908123 missense possibly damaging 0.73
R7980:Krtap31-1 UTSW 11 99908123 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAATCCAGCTCTGAATCCAGCTG -3'
(R):5'- TGGTTATCAGCGGCAGATGG -3'

Sequencing Primer
(F):5'- TGAATCCAGCTGCCCTGTG -3'
(R):5'- GCAGATGGGCACACACAGC -3'
Posted On2014-10-16