Incidental Mutation 'R2284:Nr2f1'
ID243259
Institutional Source Beutler Lab
Gene Symbol Nr2f1
Ensembl Gene ENSMUSG00000069171
Gene Namenuclear receptor subfamily 2, group F, member 1
SynonymsErbal3, COUP-TF1, Tcfcoup1, COUP-TFI
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location78188973-78199757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78195462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 81 (V81F)
Ref Sequence ENSEMBL: ENSMUSP00000153321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091458] [ENSMUST00000125176] [ENSMUST00000127137] [ENSMUST00000150498] [ENSMUST00000224798]
Predicted Effect probably damaging
Transcript: ENSMUST00000091458
AA Change: V228F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089036
Gene: ENSMUSG00000069171
AA Change: V228F

DomainStartEndE-ValueType
low complexity region 16 65 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ZnF_C4 80 151 3.01e-39 SMART
HOLI 218 378 5.16e-47 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125176
AA Change: V81F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122618
Gene: ENSMUSG00000069171
AA Change: V81F

DomainStartEndE-ValueType
HOLI 71 231 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127137
AA Change: V71F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133704
Gene: ENSMUSG00000069171
AA Change: V71F

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145613
Predicted Effect probably damaging
Transcript: ENSMUST00000150498
AA Change: V71F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118161
Gene: ENSMUSG00000069171
AA Change: V71F

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224798
AA Change: V81F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.8385 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor and transcriptional regulator. The encoded protein acts as a homodimer and binds to 5'-AGGTCA-3' repeats. Defects in this gene are a cause of Bosch-Boonstra optic atrophy syndrome (BBOAS). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for a null allele die perinatally with axon guidance defects in all forebrain commissures. Homozygotes for another null allele show neonatal death, impaired cranial ganglion IX formation and axon guidance, increased cochlear HC and support cell number, and altered cortex regionalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Nr2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Nr2f1 APN 13 78189833 missense probably damaging 1.00
IGL00553:Nr2f1 APN 13 78198242 missense probably damaging 1.00
IGL00821:Nr2f1 APN 13 78198114 unclassified probably benign
IGL02346:Nr2f1 APN 13 78195408 missense probably damaging 1.00
IGL02586:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02587:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02588:Nr2f1 APN 13 78195156 unclassified probably benign
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1865:Nr2f1 UTSW 13 78189926 missense probably damaging 1.00
R1959:Nr2f1 UTSW 13 78189816 missense probably damaging 1.00
R3861:Nr2f1 UTSW 13 78195675 nonsense probably null
R4542:Nr2f1 UTSW 13 78189821 missense probably damaging 1.00
R6248:Nr2f1 UTSW 13 78196492 intron probably benign
R6285:Nr2f1 UTSW 13 78195663 missense probably benign 0.01
R7305:Nr2f1 UTSW 13 78195179 missense probably damaging 1.00
R7496:Nr2f1 UTSW 13 78195242 missense probably damaging 1.00
R7653:Nr2f1 UTSW 13 78195597 missense probably benign 0.32
R7884:Nr2f1 UTSW 13 78189869 missense probably benign 0.03
R7967:Nr2f1 UTSW 13 78189869 missense probably benign 0.03
R8030:Nr2f1 UTSW 13 78195446 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTCCTGAAAGATGCGGATGTGG -3'
(R):5'- TGCACTCACAAACGGGGATC -3'

Sequencing Primer
(F):5'- GATGTGGTCCATGAAGGCC -3'
(R):5'- CAAACGGGGATCCTCTCAATGG -3'
Posted On2014-10-16