Mutagenetix > Incidental Mutation

Incidental Mutation 'R2284:Adsl'

243262

Institutional Source

Beutler Lab

Gene Symbol

Adsl

Ensembl Gene

ENSMUSG00000022407

Gene Name

adenylosuccinate lyase

Synonyms

MMRRC Submission

040283-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2284 (G1)

Quality Score

157

Status

Validated

Chromosome

Chromosomal Location

80948490-80970946 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80963895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 278 (P278L)

Ref Sequence

ENSEMBL: ENSMUSP00000127593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000200201] [ENSMUST00000207170]

AlphaFold

P54822

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023043
AA Change: P293L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407
AA Change: P293L

Domain	Start	End	E-Value	Type
Pfam:Lyase_1	49	313	4.4e-29	PFAM
ADSL_C	377	461	5.65e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163575

Predicted Effect

probably damaging
Transcript: ENSMUST00000164806
AA Change: P293L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407
AA Change: P293L

Domain	Start	End	E-Value	Type
Pfam:Lyase_1	47	313	8.4e-29	PFAM
Blast:ADSL_C	377	416	2e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166711

SMART Domains

Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407

Domain	Start	End	E-Value	Type
PDB:2VD6\|D	1	134	3e-87	PDB
SCOP:d1c3ca_	20	134	9e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168756
AA Change: P278L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407
AA Change: P278L

Domain	Start	End	E-Value	Type
Pfam:Lyase_1	115	298	3.9e-25	PFAM
ADSL_C	362	446	5.65e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169238

SMART Domains

Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407

Domain	Start	End	E-Value	Type
PDB:2VD6\|D	1	134	3e-87	PDB
SCOP:d1c3ca_	20	134	9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199284

Predicted Effect

probably benign
Transcript: ENSMUST00000200201

SMART Domains

Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407

Domain	Start	End	E-Value	Type
PDB:2VD6\|D	1	119	6e-77	PDB
SCOP:d1c3ca_	20	119	4e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207170
AA Change: P113L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.9668

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adipoq	C	T	16: 23,157,487	Q213*	probably null	Het
Bcas2	T	C	3: 103,178,362	S187P	probably damaging	Het
Ccdc36	C	T	9: 108,421,473	E49K	probably damaging	Het
Ccdc88a	T	C	11: 29,494,099		probably null	Het
Cryzl1	C	T	16: 91,694,305		probably benign	Het
Csl	T	A	10: 99,758,459	D248V	possibly damaging	Het
Dip2a	A	C	10: 76,313,193	V247G	probably benign	Het
Fat2	T	C	11: 55,282,360	D2509G	probably damaging	Het
Gldn	G	A	9: 54,286,565	W14*	probably null	Het
Gm5698	C	T	1: 30,977,883	R29Q	possibly damaging	Het
Gm5830	A	T	1: 78,967,698		noncoding transcript	Het
Gtf2ird2	A	G	5: 134,217,183	D761G	probably benign	Het
Hdac10	T	C	15: 89,127,404	Q159R	probably benign	Het
Hhatl	T	C	9: 121,789,582	Y118C	probably damaging	Het
Klrd1	A	G	6: 129,598,381	H127R	probably benign	Het
Krtap31-1	C	T	11: 99,908,255	Q95*	probably null	Het
Map2	C	T	1: 66,414,068	P548S	probably damaging	Het
Mki67	A	G	7: 135,699,945	V1120A	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtmr12	T	A	15: 12,245,011	M204K	probably damaging	Het
Muc6	T	C	7: 141,637,924	T2279A	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nlrp1b	A	G	11: 71,156,284	S1084P	probably benign	Het
Nr2f1	C	A	13: 78,195,462	V81F	probably damaging	Het
Nrxn3	T	A	12: 89,510,365	N803K	probably damaging	Het
Olfr1157	A	G	2: 87,962,793	L33P	probably damaging	Het
Ptpre	A	G	7: 135,669,781	H375R	probably benign	Het
Tsc1	G	A	2: 28,665,097	V200I	possibly damaging	Het
Vmn1r42	A	G	6: 89,844,699	I296T	probably benign	Het
Vmn1r67	A	T	7: 10,447,673	H288L	probably damaging	Het
Vmn2r45	A	T	7: 8,485,766	N88K	probably benign	Het
Wt1	A	G	2: 105,172,321	T511A	probably benign	Het

Other mutations in Adsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Adsl	APN	15	80948700	missense	probably null	0.24
IGL02249:Adsl	APN	15	80960475	missense	probably benign	0.26
IGL03009:Adsl	APN	15	80952243	nonsense	probably null
R0046:Adsl	UTSW	15	80962788	critical splice donor site	probably null
R0046:Adsl	UTSW	15	80962788	critical splice donor site	probably null
R0194:Adsl	UTSW	15	80961360	missense	possibly damaging	0.91
R0575:Adsl	UTSW	15	80963685	missense	probably damaging	1.00
R1111:Adsl	UTSW	15	80967660	missense	probably damaging	1.00
R1606:Adsl	UTSW	15	80952224	nonsense	probably null
R1822:Adsl	UTSW	15	80962742	nonsense	probably null
R2152:Adsl	UTSW	15	80967662	missense	probably damaging	1.00
R4008:Adsl	UTSW	15	80966156	missense	probably benign	0.05
R4010:Adsl	UTSW	15	80966156	missense	probably benign	0.05
R4011:Adsl	UTSW	15	80966156	missense	probably benign	0.05
R4202:Adsl	UTSW	15	80952216	missense	probably damaging	0.98
R4587:Adsl	UTSW	15	80967767	critical splice donor site	probably null
R5053:Adsl	UTSW	15	80960450	missense	probably damaging	1.00
R5086:Adsl	UTSW	15	80963700	missense	probably damaging	0.96
R5123:Adsl	UTSW	15	80952294	splice site	probably null
R5187:Adsl	UTSW	15	80948905	intron	probably benign
R5416:Adsl	UTSW	15	80952183	splice site	probably null
R5532:Adsl	UTSW	15	80963909	missense	probably damaging	1.00
R5898:Adsl	UTSW	15	80961353	splice site	probably null
R7401:Adsl	UTSW	15	80962782	missense	probably damaging	1.00
R8544:Adsl	UTSW	15	80948533	start gained	probably benign
R9712:Adsl	UTSW	15	80955639	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGATTGGTGAGTAGAGGCTCG -3'
(R):5'- CCCAAGCTTCTTTGAGGGTAAG -3'

Sequencing Primer
(F):5'- TCGGGAGCAGCATAACAC -3'
(R):5'- CTTCTTTGAGGGTAAGGAAGCAGAC -3'

Posted On

2014-10-16