Incidental Mutation 'R2284:Adipoq'
ID243265
Institutional Source Beutler Lab
Gene Symbol Adipoq
Ensembl Gene ENSMUSG00000022878
Gene Nameadiponectin, C1Q and collagen domain containing
SynonymsAcdc, adiponectin, GBP28, APN, adipo, Acrp30, apM1
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23146536-23158028 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 23157487 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 213 (Q213*)
Ref Sequence ENSEMBL: ENSMUSP00000023593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023593] [ENSMUST00000171309]
PDB Structure
THE CRYSTAL STRUCTURE OF A COMPLMENT-1Q FAMILY PROTEIN SUGGESTS AN EVOLUTIONARY LINK TO TUMOR NECROSIS FACTOR [X-RAY DIFFRACTION]
ACRP30 CALCIUM COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000023593
AA Change: Q213*
SMART Domains Protein: ENSMUSP00000023593
Gene: ENSMUSG00000022878
AA Change: Q213*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
internal_repeat_1 45 74 2.54e-5 PROSPERO
C1Q 109 245 2.81e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171309
SMART Domains Protein: ENSMUSP00000126793
Gene: ENSMUSG00000022878

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Collagen 61 133 1.4e-11 PFAM
SCOP:d1gr3a_ 134 168 2e-11 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased beta-oxidation in muscle and liver, impaired free fatty acid clearance, and moderate insulin resistance. Heterozygotes show mild insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Adipoq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Adipoq APN 16 23157115 missense possibly damaging 0.64
R0196:Adipoq UTSW 16 23146643 unclassified probably null
R0617:Adipoq UTSW 16 23155410 missense probably damaging 1.00
R1773:Adipoq UTSW 16 23155238 missense unknown
R2367:Adipoq UTSW 16 23155319 missense probably benign 0.05
R3767:Adipoq UTSW 16 23157188 missense possibly damaging 0.83
R7670:Adipoq UTSW 16 23157582 missense probably damaging 0.99
X0026:Adipoq UTSW 16 23155284 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACATTCCGGGACTCTACTAC -3'
(R):5'- CACGTGTGGATAATACTCAGGAC -3'

Sequencing Primer
(F):5'- ACTTCTCTTACCACATCACGGTG -3'
(R):5'- GTGGATAATACTCAGGACTCTCAAAC -3'
Posted On2014-10-16