Incidental Mutation 'R2285:Colgalt2'
ID 243268
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2285 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 152399830-152510695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152468550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 121 (N121S)
Ref Sequence ENSEMBL: ENSMUSP00000119210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably benign
Transcript: ENSMUST00000044311
AA Change: N121S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: N121S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
AA Change: N121S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: N121S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152503072 missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152503155 intron probably benign
R9186:Colgalt2 UTSW 1 152508652 missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152484847 nonsense probably null
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGTGTGGTCCATGAGAGAAG -3'
(R):5'- CAGGGAGTTGTGCGAATCTATTAATAG -3'

Sequencing Primer
(F):5'- TGACTCCACCCATTCAGAACTG -3'
(R):5'- TAGAAGAAAAGGCCACATTTGC -3'
Posted On 2014-10-16