Incidental Mutation 'R2285:Bbs9'
ID243281
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene NameBardet-Biedl syndrome 9 (human)
SynonymsE130103I17Rik, EST 3159894
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22475715-22888280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22678934 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 656 (L656W)
Ref Sequence ENSEMBL: ENSMUSP00000116629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000127296] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
Predicted Effect probably damaging
Transcript: ENSMUST00000039798
AA Change: L656W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: L656W

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124076
Predicted Effect probably benign
Transcript: ENSMUST00000127296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130479
Predicted Effect probably benign
Transcript: ENSMUST00000136084
SMART Domains Protein: ENSMUSP00000123160
Gene: ENSMUSG00000035919

DomainStartEndE-ValueType
Pfam:PHTB1_C 24 162 2.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147405
AA Change: L661W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: L661W

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147712
AA Change: L656W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: L656W

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150395
AA Change: L656W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: L656W

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160078
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2402:Bbs9 UTSW 9 22646063 missense probably benign 0.23
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5932:Bbs9 UTSW 9 22812331 missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22514069 missense probably benign 0.01
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6908:Bbs9 UTSW 9 22567723 missense probably damaging 0.96
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTCCTGAGCCAAGTCC -3'
(R):5'- CTGTCCAGCATATGTCAGTGCC -3'

Sequencing Primer
(F):5'- TCCTGAGCCAAGTCCCATGTG -3'
(R):5'- AGCATATGTCAGTGCCCTGGC -3'
Posted On2014-10-16