Incidental Mutation 'R2285:Olfr792'
ID243282
Institutional Source Beutler Lab
Gene Symbol Olfr792
Ensembl Gene ENSMUSG00000094496
Gene Nameolfactory receptor 792
SynonymsGA_x6K02T2PULF-11219415-11220350, MOR108-2
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129539162-129542534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129540668 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 44 (I44V)
Ref Sequence ENSEMBL: ENSMUSP00000149872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]
Predicted Effect probably benign
Transcript: ENSMUST00000076575
AA Change: I44V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: I44V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215436
AA Change: I44V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Olfr792
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr792 APN 10 129540842 missense probably benign 0.07
IGL01459:Olfr792 APN 10 129540541 start codon destroyed probably null 1.00
IGL02090:Olfr792 APN 10 129541307 missense probably damaging 1.00
IGL03338:Olfr792 APN 10 129541056 missense probably damaging 0.99
R0382:Olfr792 UTSW 10 129541014 missense probably benign 0.01
R1672:Olfr792 UTSW 10 129540692 missense probably benign 0.00
R2938:Olfr792 UTSW 10 129540615 missense probably damaging 1.00
R3498:Olfr792 UTSW 10 129540909 missense probably damaging 1.00
R5309:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R5312:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R6004:Olfr792 UTSW 10 129540890 missense probably benign 0.31
R6800:Olfr792 UTSW 10 129541263 missense probably damaging 1.00
R7127:Olfr792 UTSW 10 129541067 missense probably damaging 1.00
R7167:Olfr792 UTSW 10 129540738 missense possibly damaging 0.88
R7763:Olfr792 UTSW 10 129541455 missense probably benign
R7819:Olfr792 UTSW 10 129540693 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGTCACCAGATGTGTAATTG -3'
(R):5'- TGAAGAAGAACTCCTGAGCCAG -3'

Sequencing Primer
(F):5'- CAGTCACCAGATGTGTAATTGTTTTG -3'
(R):5'- CCTGAGCCAGGCAAGAGCTATAG -3'
Posted On2014-10-16