Incidental Mutation 'R2285:Clu'
ID243287
Institutional Source Beutler Lab
Gene Symbol Clu
Ensembl Gene ENSMUSG00000022037
Gene Nameclusterin
SynonymsD14Ucla3, Sgp-2, Sgp2, ApoJ, Cli, SP-40, Sugp-2, complement lysis inhibitor, Apolipoprotein J, testosterone repressed prostate message-2
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65968483-65981547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65980959 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 423 (S423P)
Ref Sequence ENSEMBL: ENSMUSP00000022616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022616] [ENSMUST00000153460]
Predicted Effect probably benign
Transcript: ENSMUST00000022616
AA Change: S423P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022616
Gene: ENSMUSG00000022037
AA Change: S423P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
CLa 227 442 2.3e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152903
Predicted Effect probably benign
Transcript: ENSMUST00000153460
SMART Domains Protein: ENSMUSP00000121633
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Blast:CLa 227 265 2e-19 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a secreted chaperone that can, under some stress conditions, also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric mature protein comprised of alpha and beta subunits. Mice lacking the encoded protein exhibit increased severity of autoimmune myocarditis, faster progression of the acute inflammation to myocardial scarring and decreased brain injury following neonatal hypoxic-ischemic injury. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive renal glomerulopathy and increased severity of myosin-induced autoimmune myocarditis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Zfp51 T A 17: 21,463,875 F251I probably damaging Het
Other mutations in Clu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clu APN 14 65975588 missense probably damaging 0.98
IGL01657:Clu APN 14 65979672 missense possibly damaging 0.81
IGL02030:Clu APN 14 65975791 missense probably benign 0.08
IGL02891:Clu APN 14 65975984 missense probably damaging 0.96
IGL03163:Clu APN 14 65979786 missense probably benign 0.06
R1378:Clu UTSW 14 65974901 missense probably damaging 1.00
R1417:Clu UTSW 14 65974971 nonsense probably null
R1711:Clu UTSW 14 65980905 missense possibly damaging 0.63
R2134:Clu UTSW 14 65974841 critical splice acceptor site probably null
R2340:Clu UTSW 14 65980909 missense probably damaging 0.99
R2508:Clu UTSW 14 65975003 missense probably damaging 1.00
R4700:Clu UTSW 14 65979864 missense probably benign 0.25
R4981:Clu UTSW 14 65973366 missense probably damaging 0.97
R5062:Clu UTSW 14 65979728 missense probably damaging 0.99
R5422:Clu UTSW 14 65975602 missense probably damaging 0.99
R6389:Clu UTSW 14 65971322 intron probably benign
R7009:Clu UTSW 14 65971832 missense probably damaging 1.00
X0025:Clu UTSW 14 65971814 missense probably damaging 1.00
Z1088:Clu UTSW 14 65976913 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGACAGAGAAGGGTGCAC -3'
(R):5'- AATCCCCGGGGTTTTCCTAG -3'

Sequencing Primer
(F):5'- CAGAGAAGGGTGCACTCTGC -3'
(R):5'- TCAGGGATAGGCCACGTG -3'
Posted On2014-10-16