Incidental Mutation 'R2285:Zfp51'
ID243291
Institutional Source Beutler Lab
Gene Symbol Zfp51
Ensembl Gene ENSMUSG00000023892
Gene Namezinc finger protein 51
SynonymsZfp-51, zfec12
MMRRC Submission 040284-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R2285 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21450374-21465587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21463875 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 251 (F251I)
Ref Sequence ENSEMBL: ENSMUSP00000045684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039577]
Predicted Effect probably damaging
Transcript: ENSMUST00000039577
AA Change: F251I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045684
Gene: ENSMUSG00000023892
AA Change: F251I

DomainStartEndE-ValueType
KRAB 43 103 1.71e-22 SMART
ZnF_C2H2 214 236 2.36e-2 SMART
ZnF_C2H2 242 264 8.94e-3 SMART
ZnF_C2H2 270 292 7.9e-4 SMART
ZnF_C2H2 298 320 3.44e-4 SMART
ZnF_C2H2 326 348 7.15e-2 SMART
ZnF_C2H2 354 376 4.54e-4 SMART
ZnF_C2H2 382 404 3.44e-4 SMART
ZnF_C2H2 410 432 9.88e-5 SMART
ZnF_C2H2 438 460 3.16e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
ZnF_C2H2 494 517 2.57e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 1.4e-4 SMART
ZnF_C2H2 579 601 4.17e-3 SMART
ZnF_C2H2 607 629 2.79e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 9.08e-4 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
ZnF_C2H2 719 741 1.36e-2 SMART
ZnF_C2H2 747 769 6.82e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,939,171 Y532H probably damaging Het
Bbs9 T G 9: 22,678,934 L656W probably damaging Het
Clu T C 14: 65,980,959 S423P probably benign Het
Cnpy4 A G 5: 138,192,825 probably null Het
Col28a1 A T 6: 8,097,078 V440E probably damaging Het
Colgalt2 A G 1: 152,468,550 N121S probably benign Het
Cpa5 G T 6: 30,615,064 V67L probably benign Het
Emilin1 G A 5: 30,918,200 R595H probably damaging Het
Fam92b T C 8: 120,168,537 N209D probably benign Het
Fat3 G T 9: 16,376,173 Q685K probably damaging Het
Gfra4 C T 2: 131,041,731 R34H probably damaging Het
Gp2 C T 7: 119,450,085 V410M possibly damaging Het
Ints9 T C 14: 65,007,997 F235L possibly damaging Het
Kcnh3 A T 15: 99,241,992 I920F probably benign Het
Mipep T C 14: 60,787,394 S95P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nxpe3 C T 16: 55,866,225 G140D probably damaging Het
Olfr792 A G 10: 129,540,668 I44V probably benign Het
Ppcs T A 4: 119,418,977 K137I possibly damaging Het
Tmc1 A G 19: 20,789,799 M731T probably damaging Het
Tubgcp6 A T 15: 89,122,474 V115D probably damaging Het
Usp54 G A 14: 20,561,178 T1190I possibly damaging Het
Other mutations in Zfp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp51 APN 17 21463452 missense probably benign 0.11
IGL00971:Zfp51 APN 17 21463582 missense probably benign 0.03
IGL02002:Zfp51 APN 17 21463959 missense probably damaging 0.98
IGL02268:Zfp51 APN 17 21463419 nonsense probably null
IGL03249:Zfp51 APN 17 21463439 missense probably damaging 1.00
R1569:Zfp51 UTSW 17 21456380 missense probably benign 0.01
R1853:Zfp51 UTSW 17 21464323 missense probably damaging 1.00
R1989:Zfp51 UTSW 17 21456320 missense possibly damaging 0.90
R2407:Zfp51 UTSW 17 21463831 missense probably damaging 0.98
R2890:Zfp51 UTSW 17 21463856 missense probably damaging 1.00
R3918:Zfp51 UTSW 17 21463440 missense probably benign
R4529:Zfp51 UTSW 17 21464736 missense probably damaging 1.00
R4587:Zfp51 UTSW 17 21464916 nonsense probably null
R4866:Zfp51 UTSW 17 21461750 missense possibly damaging 0.61
R4872:Zfp51 UTSW 17 21464671 missense probably benign 0.26
R4961:Zfp51 UTSW 17 21456353 missense probably benign 0.01
R5392:Zfp51 UTSW 17 21465322 missense possibly damaging 0.60
R5611:Zfp51 UTSW 17 21464092 missense probably damaging 1.00
R7109:Zfp51 UTSW 17 21463569 missense possibly damaging 0.80
R7129:Zfp51 UTSW 17 21461709 missense probably damaging 1.00
R7269:Zfp51 UTSW 17 21463698 missense probably benign 0.09
R7303:Zfp51 UTSW 17 21463796 missense probably benign 0.24
R7514:Zfp51 UTSW 17 21463500 missense probably benign 0.37
R7665:Zfp51 UTSW 17 21463581 missense probably benign 0.00
R8073:Zfp51 UTSW 17 21464032 missense probably damaging 1.00
R8177:Zfp51 UTSW 17 21463867 missense probably benign 0.05
X0062:Zfp51 UTSW 17 21464995 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTATTTCAGCTCTGCATACAGTC -3'
(R):5'- TCTGGACAACTACAATGTTCCTC -3'

Sequencing Primer
(F):5'- AGCTCTGCATACAGTCTCATG -3'
(R):5'- GGACAACTACAATGTTCCTCTGAAG -3'
Posted On2014-10-16