Incidental Mutation 'R2286:Dtd1'
ID243296
Institutional Source Beutler Lab
Gene Symbol Dtd1
Ensembl Gene ENSMUSG00000027430
Gene NameD-tyrosyl-tRNA deacylase 1
SynonymsHars2, 0610006H08Rik
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144599897-144768758 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 144635866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028917] [ENSMUST00000028917]
Predicted Effect probably null
Transcript: ENSMUST00000028917
SMART Domains Protein: ENSMUSP00000028917
Gene: ENSMUSG00000027430

DomainStartEndE-ValueType
Pfam:Tyr_Deacylase 2 146 1.5e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028917
SMART Domains Protein: ENSMUSP00000028917
Gene: ENSMUSG00000027430

DomainStartEndE-ValueType
Pfam:Tyr_Deacylase 2 146 1.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145814
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to histidyl-tRNA synthetase, which hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr). The encoded protein binds the DNA unwinding element and plays a role in the initiation of DNA replication. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Dtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03069:Dtd1 APN 2 144747061 utr 3 prime probably benign
R0039:Dtd1 UTSW 2 144746976 missense probably damaging 0.98
R1567:Dtd1 UTSW 2 144747025 missense probably damaging 1.00
R5307:Dtd1 UTSW 2 144747022 missense possibly damaging 0.90
R7511:Dtd1 UTSW 2 144617227 missense probably benign 0.22
R8013:Dtd1 UTSW 2 144617332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGGATGGCCATTTGTC -3'
(R):5'- AGACATGCTCAGGAGTTCTTG -3'

Sequencing Primer
(F):5'- TGTTGTCTGGCAGGCCC -3'
(R):5'- TCAGGAGTTCTTGAGAAGAGAGAAAG -3'
Posted On2014-10-16