Incidental Mutation 'R2286:Setd5'
ID243300
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113119610 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 592 (N592K)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042889
AA Change: N573K

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: N573K

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113155
AA Change: N592K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: N592K

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113157
AA Change: N592K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: N592K

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCATCATGCATGCTTTTG -3'
(R):5'- CAAATGTTGACCTCACCTGTC -3'

Sequencing Primer
(F):5'- CATGCATGCTTTTGAATCTTTAGAG -3'
(R):5'- CCAGCTGTTGAGATCAAAATAGC -3'
Posted On2014-10-16